Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3845
Length(NT) : 1080
Best Gene Model Blast : Link to GSTUMT00011764001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein BC1G_11124
Accession: ref|XP_001550058.1| Score: 314 E_value: 5e-27
KEGG Definition: hypothetical protein
Accession: mgr:MGG_02522 Score: 293 E_value: 7e-25
KOG Definition: No Hit Found
PFAM Definition: DASH_Dad2, DASH complex subunit Dad2. The DASH complex is a ~10 subunit microtubule-binding complex that is transferred to the kinetochore prior to mitosis. In Saccharomyces cerevisiae DASH forms both rings and spiral structures on microtubules in vitro..
Pfam Number: pfam08654 Score: 264 E_value: 7e-24
Swissprot: Q6BV14|DAD2_DEBHA
Gene Ontology:
GO:0005819 = Cellular component: spindle

Sequence:
>Contig3845
CTGGCGCAGGAACCGCTTCTTGAGTGCTTCCAGCGACTCCGTCTGGGGGT
CATTAAGTCTTGCCATGCATTAAAGAGGTGATATAAACCAGCCCTTGAGT
GGAGGATTTGTGTGTAGTTGAAAAATAGAGAAGGACTAACGATGTGGTGG
AGGACTGAGAAGGGTATGGAAGTGTAGACAGCGAATATGGTTGTTTGCTA
ACACCTGTATCATAAGCAAGAAGGGCATGGAGGAACCGGGCATTGCTTGT
TGATGTTTCGCCTAAATAGGTTAAGCGTATGTTTTTTCCCGCGCGACCGC
GTCCTGTCCATGGCAACCAGATGGTCTCTCTGTGTGACCGCTCTAATGTT
TTTTCTTTTACGCCTCAAGAGCTTGGAGTTGCTCTTCCACATCACTTCCT
CAACATCTCTTGATATCAATCATCTTTCAACGTCCCAAAGATGGCCAACC
CGTATCCGAACCGTTATTCACAGCATTTCCGGCAGCCATCTGCCTCGGGG
TCATCTGGTATGGGAGGATCTCAACAATCTCCTGCGTTGTCTGCCCGGAT
AAACGAGAAGAAGCAAGAACTTGAGAATCTACAAGCTCTACGGGATTTAT
CAGCGGGGTTAGCATCACAGATGCAACAATTGGAAGAAAAGCTGGGAACA
CTAGCAGACGGAACAGAAGCTGTTGCCGCAGTGTTATCCAATTGGCACAA
CGTTCTACGAGCTATAGCTATGGCTTCTTCTAAAATACCCATACCGAAGG
ACCCCGCAGCTGACGACAACCCGTTCGCACCTACGAAGAAAACGGATGAA
AACGAAGACCTAGGAAAGGATGGAAATGGCGTCCCAATGCCACAGACACT
CGTCAGGATCCCGGTACTACCACAACCATCGAAATGACCTACTGGATTGG
ATTATATGAGATCGCCGCTCTTTTGTGTTGGTCGGAAGCTTATTCTCGGT
TTGAAGGTGTGGTTGATCGCATATGATTGGAGTTTGGAGTTTTGATTAAT
CGCCCATAAAGATCGAGATATCCTTGGATAAAGGGAGTAATACATTCCAC
CTCCTTGACGTTTTGAATCCCCTCTCCCAA

Sequences in the Contig:

SY0AAA12YK06FM1 SY0AAA38YJ10FM1 SY0AAB55YK24FM1
SY0AAC18YI09FM1