Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3844
Length(NT) : 616
Best Gene Model Blast : Link to GSTUMT00004791001 E-value : 1e-126
Numbers of ESTs : 2

Blast Results:

Nr Definition: peptide methionine sulfoxide reductase
Accession: ref|XP_001265878.1| Score: 254 E_value: 1e-37
KEGG Definition: peptide methionine sulfoxide reductase [EC:1.8.4.11]; K07304 peptide-methionine (S)-S-oxide reductase
Accession: afm:AFUA_2G03140 Score: 252 E_value: 1e-37
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1635 Score: 259 E_value: 1e-23
PFAM Definition: PMSR, Peptide methionine sulfoxide reductase. This enzyme repairs damaged proteins. Methionine sulfoxide in proteins is reduced to methionine..
Pfam Number: pfam01625 Score: 257 E_value: 2e-23
Swissprot: Q9HQG0|MSRA_HALSA
Gene Ontology:
GO:0008113 = Molecular function: peptide-methionine-(S)-S-oxide reductase activity
GO:0006464 = Biological process: protein modification process

Sequence:
>Contig3844
TAACGCTCACGACAACGTTAATGTTCACATCTCTCCTCCCTCGCTTCTTC
CGCCTCTTCTCAGCCAGCAAATTCACCTTGGGTCCTCTCGGCGGCAACAT
GTCCCTCCCGGAGACCACCGAAAAAGCAACATTCGCCGCTGGGTAGATAT
ACCCTTCCGTCCCCGCTGGCATTTCAATACTAACAAAAATGTGGGGGAAA
AAGGTGCTTCTGGGGTGTCGAACATCTCTTCCGCAAACACTTTACAGGCA
AAGGCCTGTTGGATGCTCGAGTCGGCTACATAGGTGGGGACACCGCACAC
CCAACCTACCGTTCCGTTTGTTCCGGGACAACCGGCCGTATGTACCTACT
GACGTCCCCTTCTCACTCCCCATACCGCTAACATTACCAGATGCCGAGGC
GCTCCAAGTTCTCTATAACCCTTCAGAAGTCACCTACGAGAAACTTCTAG
AATTCTTCTTCCAGATGCACGACCCAACAACGGTGGATCGCCAGGGGCCA
GACGTGGGATCCCAGTATCGCTCGGCGATATTCTTTCACAATGACAAGCA
GGAGGAAGCTGCCAAAGCGGTGCTGGAGAAAGTTACGAAGCAGTGGTATA
AGACCGACATGGCGAC

Sequences in the Contig:

SY0AAC18YG02FM1 SY0AAC57YP10FM1