Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3843
Length(NT) : 834
Best Gene Model Blast : Link to GSTUMT00004251001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0670 Score: 212 E_value: 6e-18
PFAM Definition: DUF1777, Protein of unknown function (DUF1777). This is a family of eukaryotic proteins of unknown function. Some of the proteins in this family are putative nucleic acid binding proteins..
Pfam Number: pfam08648 Score: 157 E_value: 1e-11

Sequence:
>Contig3843
TTGGCGAACACCCACGATATCAGCGTTTTGATCATCCACAGCCTTACGCC
CTTCTAACAGTCATAGGGATATCCTATTTTCTCCTTCGACAACTCTGTTC
ACTTTTGGTTTCTGCCGGACTGATATTCTATCCGAATATTCATAAGAAAG
GGTTCGAATCTCATCGCTTCCTCCCTCTGCCGCGCTCGCACGGCGAAATA
ACAATATCCTAACAACTTATACCCCCGCTTACAGTGAATAAGCTCCCCAT
ACCCAGCGTTTCTCCCAAAGTTTCGAGCAGAACAAAGAAAAAAAGAAAAT
ATAAAAAAAAGGCAAGATGTCTGGTCTAGACGTAGAAGCCCTTCTCGAAG
CCTCCGAAGGGACTAAGCCAAGACAGCAACCTGATCGTCACGATAGTGCT
GCTTCTACTCCGAGGCCCGACCGCAACGGCGGCGGGAGCGTTAAATCTTC
TTCTTCTAGAAGGGACCGAGACGGCGAACGAGACAGAGACCGCGATAGAG
ACGACAGAAGCCCGCGTAGTGAACGCCATCGTGAACGCAGGAGAAGCAGA
AGCAGGGATAGCGATAGACGCCGTTTAGGTCGTAGAGATTCCTACTATGA
TGGTGATGAATACTATGAGTCTTCATCTCGATACAGCAGGCACCGCTCCT
GCGAAAGGGATGATGACAGGTATTACTCTGGACGCGGTCGAGATCGCAGA
TATAGGGATTACTACGACGAGCGTGACAGAGATGATTATTACAGAGGAGA
TAGGCGTGACCGTGATCGAAGATCAAGGAGTCCAAGGAGGCGAGGTGGCC
GAGGAAGGACTAGGTCTCGCTCTCCTCAGTTGAC

Sequences in the Contig:

SY0AAA11YA13FM1 SY0AAA32YA02FM1 SY0AAA57YI03FM1
SY0AAB33YL10FM1 SY0AAC18YF13FM1 SY0AAC26YI12FM1
SY0AAC26YI18FM1 SY0AAC7YO17FM1