Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3842
Length(NT) : 988
Best Gene Model Blast : Link to GSTUMT00005189001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: Dhp1-interacting protein Din1
Accession: ref|XP_747571.1| Score: 565 E_value: 4e-56
KEGG Definition: Dhp1-interacting protein Din1, putative
Accession: afm:AFUA_6G05060 Score: 565 E_value: 2e-56
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG1982 Score: 341 E_value: 9e-33
PFAM Definition: RAI1, RAI1 like. RAI1 is homologous to Caenorhabditis elegans DOM-3 and human DOM3Z and binds to a nuclear exoribonuclease. It is required for 5.8S rRNA processing..
Pfam Number: pfam08652 Score: 214 E_value: 5e-18
Swissprot: Q4WDK5|DOM3Z_ASPFU

Sequence:
>Contig3842
TTGGCACTCCACCATCACCAGCGCTGCCAAAATGTCCACCCCGATCCACA
CCTTTTCAATAACTCCACTAGCTCAATTCTCCAACAAAAACTCTCAGATC
CGCCGTCCCCAGGAAATCACGCACTTCTCATACGATGACCGCCGCCGCCT
CCACCACGACCCGTCCTCGCTAAAATCTTACTACCCCCCGCCGCTGGGCA
GTGATCTGTCGCGTGGATTCGAGAGCTTCCGGAAACATGATAGTAGCATA
GACGAGCATTTGGATGGGCTATTGGAGGCGATTGTTGAGTTTGAGAGGAG
GAGCGGGCAGAAAGTTGCTGCCGACGTTATCACTTGGAGGGGGATGATGA
CTAAGTTTATGGTCTTGCCGTTTGATATGCGAGATGGGTTTGTTGTCATA
TCTTCCTCCATCTTCGCAGTCGGCGGGTCAAAGGAGAGCAACAGGCTAAT
GCGCGCAGCTTCGAAATGAATGCTATAAAGTTTCAAGGCTCAATGTACGA
GCACCATCCGCTCTGCCATCCATCCATCAACCAATCCCCCACTAACCGTT
CCCTCCAGCTTCATTGAAGAAAACCACTCCTACAAGCTAAACTCCCAAAG
CGTGCCGTTCCCCCGTCAAGACTTAATGACATATTGGGGCTACAAATTTG
AAGAAATCTCCACTCTTCCCGGTAATCCTTCAGACTTTTCCCGCGAGGCC
ATAGAATTGCGCGACCACAACATTGTGAATAACGAGGAACAATTCTGCTC
GATTGTGAAGACTGGTTTCGGTGGTGTCAGACTGATTATCGGTGGGGAGG
TTGATGCTGTATGGGACCAGAACCCTCCCCCGGACCCGCTGAACAAACCT
CCGGTTTACGTGGAGCTCAAGACCTCAAAAACCCCACGGCGCCCACACGA
GCATGTCAATTTTGAGCGTAAGATGTTGCGCTTCTGGGCTCAATCGTTCC
TGCTTGGGATAGCCAAGGTTGTGGTTGGCTATCGTGAC

Sequences in the Contig:

SY0AAB32YA07FM1 SY0AAC18YF11FM1 SY0AAC20YK07FM1
SY0AAC41YN08FM1 SY0AAC46YP08FM1 SY0AAD53YM13FM1