Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3841
Length(NT) : 746
Best Gene Model Blast : Link to GSTUMT00011058001 E-value : 1e-151
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_03034
Accession: ref|XP_001793623.1| Score: 242 E_value: 6e-19
KEGG Definition: AGL195Cp; K03126 transcription initiation factor TFIID subunit D10
Accession: ago:AGOS_AGL195C Score: 230 E_value: 8e-18
KOG Definition:
Classification: [Transcription].
Kog Number: KOG1142 Score: 217 E_value: 1e-18
PFAM Definition: TFIID_20kDa, Transcription initiation factor TFIID subunit A..
Pfam Number: pfam03847 Score: 154 E_value: 3e-11
Swissprot: Q03761|TAF12_YEAST
Gene Ontology:
GO:0000124 = Cellular component: SAGA complex
GO:0046695 = Cellular component: SLIK (SAGA-like) complex
GO:0005669 = Cellular component: transcription factor TFIID complex
GO:0016251 = Molecular function: general RNA polymerase II transcription factor activity
GO:0042802 = Molecular function: identical protein binding
GO:0000114 = Biological process: G1-specific transcription in mitotic cell cycle
GO:0016573 = Biological process: histone acetylation
GO:0006367 = Biological process: transcription initiation from RNA polymerase II promoter

Sequence:
>Contig3841
TTGGGGGACAACTTTGTACAAAAAAGTTGGCGCTGCTCCGCAACCTATCG
CCGTCCCTGCTGCCAGACCAACTTTAAGTGGTGGTATGAATAGTTCCGGC
AATCAGATGATGAGTACTCCCGCTATTACTAAGCAGCCTGCATTTGAGTT
TGATGAGGGTGGCATGGGCTTGTTGAGCAAGAGAAAGTTGGAAGAGCTTG
TCAAGCAGATCGATCCGGAGGAGAGATTGGATCCTGATGTTGAAGAGGTA
TGTTATCTTTAAATCTCACTGGAAAGTTTGCCATATGCTTCGGGATTTGG
CATTTCAGAATTTCCCGCCGCGGTGCCCAATGTTTGCTCTGCTATGCCAT
GTGCTGCAGACATCCTGTACTAACTAAATCGACCCAGGCTATTCTCGAAC
TCGTCGACGAGTTCATCGATTCGATCGCTACCTCAGCCTGCAAAATGGCT
AAACTTCGCGGCTCTGACACCCTGGATCTCAAGGACGTTCAAATAATTCT
TGAGCGCAACTGGAATATTCGCATTCCCGGCTACGCGGCCGACGAGATCC
GCACTGTCAGAAAATTCCATCCAGCCCCTGGATATCATCACAAGATGGCC
GCACTAGCTGCTCAGAAGCAGTTGGCTCAGACTTCCGGTAAGGGTGGAGA
ATAGGTGGGAGCGGGGTGGGGGAAACCATCACAGTACTTGTTAGGTTCAC
TTTTTATTTTATTTTCTTTGCATTTCTTCTCGGTTTTCCCCATATC

Sequences in the Contig:

SY0AAC18YE15FM1 SY0AAD13YM23FM1