Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3840
Length(NT) : 1115
Best Gene Model Blast : Link to GSTUMT00008083001 E-value : 1e-177
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_04324
Accession: ref|XP_001557074.1| Score: 170 E_value: 3e-10
KEGG Definition: hypothetical protein
Accession: ang:An11g06610 Score: 162 E_value: 1e-09
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG3199 Score: 170 E_value: 7e-13
PFAM Definition: No Hit Found
Swissprot: Q06178|NMA1_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0042802 = Molecular function: identical protein binding
GO:0000309 = Molecular function: nicotinamide-nucleotide adenylyltransferase activity
GO:0019674 = Biological process: NAD metabolic process

Sequence:
>Contig3840
TTGGCTCCATCACTGCTATTGCTCGCCGCCATGACATTTCACCCTCGACT
ACGATTGACCGGAACAAAGGCTACAATCTCAGGATATCACTCGTCTCTCG
GTTTTCCTTTTTGAGACACAGTCGTTGACTCGGGGTGGACCTGCAGTCAC
CTCCTTGTGCCTTACTCGTAGGGCAGGCCGTTTCCCGTGGGGAAGACTCT
AGTGATGGGGAGCTCGGTTAAGTCAAAGTCATACCGTTAATTTATTTTAT
TTAATCTCCAAGAAAATACGATTGGTATCGAATCGAAATCACCTCCCAAG
AGACCAATTTCGTCTTTATATATCTTTCAAGGAAAATTCAGCCGTGAGTA
CGATGCTCTATCAGTTTCAGAAGCCGTCAAAAAGAATAAAGAAAAGAAAA
GAAAAACCCTTGAGAGAGACGTAACTAATAAAATAGAAAAACAGGGGATC
GTCCAGTTTAAACAGCAGAAACCCAATTTGGTCTGGCCATTGCTCTACAT
AGAAAAGGCAAGCCCCAAGAGAAGGAGACAACGAATAATAAAAAGAAAAA
GGGGTATCATTTCCGTATAACATTTATCGCCGCTCTGGGCTTGGGTAATC
GTGGGGGTATATAGAATCCAACTAACCAGGAAGAGTTGAACCCATCCATT
GGATTTCGGTTTGCCGGAAATTTCCTTGGACCTCAATCCGAGCGTTTTTT
GGCCTTATTTTTTTGGTCCGCCGAGTGCGCACATCACCCCTACGCCTCCC
AACGGCCTTGCACCTGAAAGTCCGCTAAACTTCCCACTGTCAAATTAGGC
CACTCTTGCTCCGTCGCTCGCGGTACCTGAGCTTCCCTCCATCATTTTCC
CCTTGCCTTTCCCTTTTCCGTCACCCAAGGGGTGACTATCCTCAACCGGG
TCTCTATACAATTGGTGCTCCCTCAGGTATTCAATGACGCAGCTGGGAAG
TAGGTACTGAACACTAATCCCCCATCTCAAGAATTGCCTGATCCTAGTAC
TACTGATATCGTTGGCAATCAATTGCCGAACAACCTGGATGTTCTCCAAC
CAGTTCTTTCCCATCTTCTCGCTCCACTCGTTGAGCGGAGCCAATGCATC
ACTGACATTAGCCAA

Sequences in the Contig:

SY0AAB59YB21FM1 SY0AAC18YE10FM1