Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig384
Length(NT) : 1221
Best Gene Model Blast : Link to GSTUMT00000333001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig384
TTGGACCCCCTACTCCTCTTCCTCCTCCTATAACCATCCTCCCTCAAACC
CTTCTCTATCTGATATCACCAAGATGTCCTCGCCGCCCTACTCTACCAGC
CAGCTATTGACCACGGTCATGAAGAATCCAACTGTCCTTGTACCGACCCC
ATCGACAACTTCAACATGGGAATCGGGGGATTTCCGCAATATTACTTATT
CAACAATAAAGCTGCCCGCCGGAGCCACAGAGGATACTACATTTCAAGTA
ACAGGTCCTGGAGGACCCACGGGTCTCCGGAGGCAGGGTCAGGAGCACTT
GTACACTGTAATAGCTATAGGGCAGCCATTACCCTCAAATGAATCGACGA
GCACCACGACCACGGGAAATTCAGCCTCTCAGCCTCGCAGCAAGCCCACC
GCCGAGCCCGCCCCCTCACCCCCCGCCGCGCCCACCGACATACCAGTAGC
CACCGGCGGGGCTACATTGCCGACTCCCCTACCTGCCCAACAGACGGGCT
CGAGCGATAACGCCCCAAAAGTGGTAGCAGGTGTCATAGGGGGATTATTT
CTTCTCACCTTGGCGGCTCTTCTGTTCTTAATATTTAAGCTGAGAAAGGC
CGCAAAAGACCGCGCCCTCTCTCCACCAGCGATGGTATTCACAGAAACCA
GCTCTGCAAAAGGCCAGTCTACAATCAGCGAATTAAGCGCCAGAAACACA
GACCTAATGAACCAACTCGAGGAACGAAACGCGCAACTCTCTGCTCTGCA
GGCGACTCTGATGCGCTCCAATAGTGCGCCCCCATCTCTGGATGATCGCA
GCATAGCCTCGCGGTTTAAGCAGCTTGAGCAGGAATTGAAAGATTGGGTC
ATTATACATTTCAAGTCCACGGAACAGCGCCCCGATCTTTCACCGGAGCT
GCGAGAGATCCTGATTTCTCAGGTTCCGCTATTCGATCGGTTGCTGCAGC
AGCCTAGGTCCCGAACCATGGTGCTCCGCGCGGTCGCTGGGTACGTTTTC
CAGAAAGCGTTTGAGAATGGGGAGTTTGCCGGGGTTGGGGAGGGCCTTGG
AGCTTTGGAAAGGAGCATGGGGAGGATTACTTCAGAGACTGAGTTCAACA
AGTGGCGTTCCCAAACATTCCTCATCCTCTCGAAGGCCTCCACTACGGAA
TCCAAAGCACAGGTCGTCGCGACTATCTCCCGACGCATAGACAGCCTGTT
ATCCCCCTTCTCCACAACTGC

Sequences in the Contig:

SY0AAA22YI09FM1 SY0AAA31YO09FM1 SY0AAA42YE11FM1
SY0AAA52YN19FM1 SY0AAA61YK06FM1 SY0AAA6YC12FM1
SY0AAB11YC15FM1 SY0AAB15YP14FM1 SY0AAB43YP04FM1
SY0AAB48YK20FM1