Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3839
Length(NT) : 708
Best Gene Model Blast : Link to GSTUMT00004115001 E-value : 1e-164
Numbers of ESTs : 6

Blast Results:

Nr Definition: glycerol 3-phosphate dehydrogenase (GfdA), putative
Accession: ref|XP_001269919.1| Score: 554 E_value: 4e-55
KEGG Definition: glycerol-3-phosphate dehydrogenase/dihydroxyacetone 3-phosphate reductase [EC:1.1.1.8]; K00006 glycerol-3-phosphate dehydrogenase (NAD+)
Accession: aor:AO090005000883 Score: 550 E_value: 5e-55
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG2711 Score: 452 E_value: 7e-46
PFAM Definition: NAD_Gly3P_dh_N, NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus. NAD-dependent glycerol-3-phosphate dehydrogenase (GPDH) catalyses the interconversion of dihydroxyacetone phosphate and L-glycerol-3-phosphate. This family represents the N-terminal NAD-binding domain..
Pfam Number: pfam01210 Score: 308 E_value: 3e-29
Swissprot: Q7Z8E7|GPD_COLGL

Sequence:
>Contig3839
TTGGGACAACACGAGACGCTACAACATTCCTATCTTACCCCTCCCATCCA
CCATTAATCCCTCGGATAGTCCGGTGCACAAGACAGAGAGACAGAGAGAA
AGAGAGAAAGGGAGGGAAAAGAGGAAAGAAAAAAAAAAAAGGGGAGAGCC
TTTTCACACGTGTTCTATAATATCTGTTCATCGAGCAAAAGCAAAAGGAC
AATGGGAACTAAAACTCGGGTTGGAAGTATGAAGCATCGTGTTACCGTTA
TTGGGTCAGGGAATTGGGGGAGCGCAATTGCAAAGATTGTAGCGGAGAAT
ACGAAGGCTAATCCGGATGTTTTTCACGAGGAGGTCAAGATGTGGGTGTT
CGAGGAACAATATCAGCTCTCCTCCTCGCACCCTCGTTATGACAAGAGCA
AGCACTCTGGTTCTCAGAGCCTGACGAGCATCATCAACGGTATCCACGAG
AATCCAAAGTACCTCCCCGGGATTGCCCTTCCGACGAACCTATTCGCCAC
GCCGTCGCTTCCCGATGCCGTGTCCGAGGCTTCGATCCTGATTTTCAATG
TGCCGCACCAGTTCGTTTCCAGCATTTGCCGGCAGATCAACGGATCCTGC
CTGCCGTATGCTCGGGCCGTTTCCTGCATCAAGGGCGTGGATGTTTCACC
GGATGGGATTAGCTTGTTCTCGGATACCATCGGCCGGAAGCTAGGAATCT
ACTGCGGA

Sequences in the Contig:

SY0AAC18YB18FM1 SY0AAC18YD23FM1 SY0AAC50YK15FM1
SY0AAD22YO23FM1 SY0AAD24YF06FM1 SY0AAD30YN16FM1