Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3838
Length(NT) : 993
Best Gene Model Blast : Link to GSTUMT00005850001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein MGG_01819
Accession: ref|XP_363893.2| Score: 1220 E_value: 1e-132
KEGG Definition: hypothetical protein [EC:2.4.1.1]; K00688 starch phosphorylase
Accession: mgr:MGG_01819 Score: 1220 E_value: 1e-132
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2099 Score: 1079 E_value: 1e-118
PFAM Definition: Phosphorylase, Carbohydrate phosphorylase. The members of this family catalyse the formation of glucose 1-phosphate from one of the following polyglucoses; glycogen, starch, glucan or maltodextrin..
Pfam Number: pfam00343 Score: 1083 E_value: 1e-119
Swissprot: P06738|PHSG_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0008184 = Molecular function: glycogen phosphorylase activity
GO:0005515 = Molecular function: protein binding
GO:0005980 = Biological process: glycogen catabolic process

Sequence:
>Contig3838
TTGGGGTTACGATTTCCTCCAGGACCTGACCAAGCTCAGCGTGTTAGAAA
AATATATTGATGACAAGACATTCAAGAAGGAGTGGATGGAGATCAAATTG
GCTGCTAAAGTCAAGCTTGCAAAGTACATTAAGGACACAACGCAAATTGC
AGTCAACCCGCACTCTCTTTTCGATATTCAAGTCAAGAGAATACATGAGT
ATAAACGCCAACAAATGAATATTTTTGGTGTCATTTATCGTTACCTCAGG
CTGAAGGAGATGACACCGGAAGAGCGCAAAAAACAGGTTCCCAGGACCTC
CATCTTTGGAGGTAAAGCAGCTCCTGGGTACTGGATGGCAAAAACAATCA
TTCGTTTGATCACCGCTGTGGGTGAAGTTGTTAACCAGGACGAGGAGACA
AACTGTCTACTCAAGGTTATCTTCATTGAAGACTACAACGTCAGCAAGGC
AGAAGTCATCGTCCCTGCTTCAGATATCAGCGAACATATCTCCACTGCCG
GCACCGAAGCCAGTGGTACTAGTAACATGAAGTTCGTCTTGAATGGTGGT
TTGATTATTGGAACTTGCGATGGTGCCAACATTGAAATCACTCGTGAGAT
CGGCGAAGAAAACATTTTCTTGTTAGGTAACTTAGCTGAGCATGTTGAGG
ATCTCCGCCACCAGCACCGTTTTGGCAAGGATGTCGTGATGGATCTCAAA
CTTCGAGAAGTTTGTGATGCTATCGAGGCAGGACGATTTGGCCCTGAACA
GACATATTCTGGGTTGATGTCAGCCCTCACTACAGGTTGCGATTACTACC
TTGTTAGCGATGACTTTTCCAGCTATATCGCTACCCAAGACTTGGTTGAC
GAAGCCTACAAAGACCAAGACGGTTGGGCTACCAAGTCCATCACAAGTGT
CGCCCGTATGGGATTCTTCAGTGCGGATCGGGCTATCAATGAATATGCCG
ACGAGATTTGGAATATTGAACCATCGAAGATTGAGCCGAGGTC

Sequences in the Contig:

SY0AAC18YD07FM1 SY0AAD2YK16FM1