Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3837
Length(NT) : 1117
Best Gene Model Blast : Link to GSTUMT00007076001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein MGG_00460
Accession: ref|XP_368784.2| Score: 537 E_value: 8e-53
KEGG Definition: hypothetical protein [EC:1.1.1.100]; K00059 3-oxoacyl-[acyl-carrier protein] reductase
Accession: mgr:MGG_00460 Score: 537 E_value: 4e-53
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0725 Score: 385 E_value: 8e-38
PFAM Definition: adh_short, short chain dehydrogenase. This family contains a wide variety of dehydrogenases..
Pfam Number: pfam00106 Score: 182 E_value: 3e-14
Swissprot: Q9RPT1|RHLG_PSEAE
Gene Ontology:
GO:0004316 = Molecular function: 3-oxoacyl-[acyl-carrier-protein] reductase activity

Sequence:
>Contig3837
TTGGGTGCTCGAGGAAGGCATCGTCATTGACAAAAACCTTCCACCAAAAC
GCAGTCCCGTGAGGATAAACGGATCATAGCTTTGCGCTGCAGCGTGGCGT
CAACGACTCGTTACAATGTCAGAAGTTCAAGCGAGCACGCTTTTCTCGGC
GAAAGGTTTGGTGGCTGTGGTCACGGGTGGGGGCACAGGAATCGGCTTGA
TGATCGCAACCGCCCTGGAGCATAATGGTGCGACAAAAGTCTATATCGTC
GGCCGTCGCAAGGACGTTTTGGAAAACGCGGCGAAAGTGCACTCCAAACA
CGGCAATATAATCCCCCTCGTGGGGGAAGTCACTTCGAAAGAATCGCTGG
CGGCTATCGTCAAGACTATCGAGAGTGATGTCGGATATGTCAACTTACTA
GTCAACAATGCCGGTATGTGCGGTAGAAGGCACAACGTCCTTCCCAGGCC
ACCGCCGCTCGAAAACCTCCCGGAGGCGGAAAAGTATAAGAGTATAGAGG
ATGTGCAAAAGTTCTTGTGGGAGGATTCCATGGAGGAGTGGGAGGATACC
TTTAGGGTTAATGTCACTGGCGCATGGTTTACCAGCATCGCATTCTTGGG
ATTGCTGGACCAAGGCAACAAACTTGGGGCTGTGGAGCAGAGTAGCCAGA
TCACAACCGTAACTTCGATCGCTAGCTTCCTCAGAAATATAAGCTCTTGT
TACTCCTATCACGCCAGTAAAGCCGCGGCGACACACGTTGCTAAAATGCT
CGCGACTCACTTCCCGCAGTATGGGATTCGCTCCAACGTGATCGCCCCAG
GGTTATTCCCCTCAGAAATTACCGCAGGACAAGGGACTATGGACTCGGGA
AATAAGAATAAACTGGGAGATTACCCGCCCGGGGAAATCCCGTTGAAGAG
GCCGGAGAATGATAATGATATGGCTGGCGCGGTACTGTACCTGGCTGGAA
GAGCTGGAGCATACTTGAATGGGAACGTGGTGGTTGTTGATGGAGGCAGG
ACATCGATCATGCCGGCCACATATTAGTCTCCGAGATTGACAGCTGCCAG
TGGATGAAGGTTCCAGATCCGTAGCTTCGGGCGGGGAGAGGGCTACAAGA
TTCATGGGTTATCCCGC

Sequences in the Contig:

SY0AAC18YC14FM1 SY0AAC3YN02FM1 SY0AAC3YO09FM1
SY0AAC49YC17FM1 SY0AAC54YE19FM1 SY0AAD28YC22FM1