Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3836
Length(NT) : 608
Best Gene Model Blast : Link to GSTUMT00000673001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3836
TTGGCACAAAAACCACAACTCCCCGTCCCCCATCACCAATTCCGCCTATC
TTCTTAGCCGTCCAGCTGTTCGATTCCTCCCAATTGCCCTTGCCACGATG
TTTTGCAACTGGGCGGCCGTTGCGGCAACATCGATCCGAGGCCGAGACAG
ATCTCCATCCAGTGGCCCTGAGATAAAGCCGCCCGTACCGTTTACTGGAC
CGAAAATATTCCCCCGCTACTCTCCCCCTCAAACCTCAGGTTCAAGTTTC
ACTGCTCCACCCCAGGAACGCTCCTTCTATACCTTCTTTGGAAGGATCAA
GAAGGCTACCGAGGTCACACCCGAGCACCTTAACGCTCTCGGGGTTTTGG
TGGAATACGATGTTCCGGTTGAGAAGCTTCTACCCAGCGGTGGAGCCAGC
TTTATCCCGGTCGATGATGACAAGATATTTTCCGAGAGAAGGAGGGAATT
GCTTATCCCAAACGATGACGCAGTGGAGGCTCTTGCAAGACGGAGGAAGG
ATGTCAAGCTAGGTCACATGTATAGGTTTTATCAAGGGGTCGACATGGTT
AAAACATACTATCCCACTGAACCCCCTTCCGATCCCCTAACACCGATGTC
ATCAGGCG

Sequences in the Contig:

SY0AAB23YC09FM1 SY0AAC18YC09FM1 SY0AAD15YK18FM1
SY0AAD43YA10FM1