Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3833
Length(NT) : 608
Best Gene Model Blast : Link to GSTUMT00004476001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: RER1 protein
Accession: ref|XP_001208849.1| Score: 587 E_value: 4e-59
KEGG Definition: Golgi membrane protein (Rer1), putative
Accession: afm:AFUA_2G10930 Score: 574 E_value: 6e-58
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1688 Score: 573 E_value: 6e-60
PFAM Definition: Rer1, Rer1 family. RER1 family protein are involved in involved in the retrieval of some endoplasmic reticulum membrane proteins from the early golgi compartment. The C terminus of yeast Rer1p interacts with a coatomer complex..
Pfam Number: pfam03248 Score: 595 E_value: 1e-62
Swissprot: Q498C8|RER1_RAT
Gene Ontology:
GO:0000139 = Cellular component: Golgi membrane

Sequence:
>Contig3833
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTTGATCTCGAAATTTTTTA
CCTCAGTCGCTCCTTTCAACCACACCATTCACAGCAAAATCAACTACCTC
GACATCACAAGTGCCATTGTACCATGGATTCGCAACCTCCGGAGCAGGCT
TTTCCGGCCGCATTCAGTGCTCATACCTCGCGCTTCACTCGGCCCTTGCA
ACAGACGTACCAAACATACCTTGATAAGGTCACCCCGTTTACTCCCTATC
GATGGATCGGAACGGTTGTATTGCTCTTGATCTTTATGGCGAGAATCTTG
ATAGCTCAGGGATGGTATATTGTTTGCTACTCTCTCGGCATTTATCTTTT
AAACTTATTCATCGCTTTCCTCACACCTAAGTTTGATCCCTCCCTTGAAC
AAGATGACGAGCTTGAGTCTGGGGGTCCGAGTGCTTTGCCTACAAAGCAG
GATGAGGAATTTAGACCCTTTATTAGGAGATTGCCCGAATTCAAATTCTG
GCATAGTGCCACCCGAGCCATTTTCATCGCATTTGTGGCGACCTGGATTC
GGGCAACTGATATTCCCGTCTTCTGGCCCGTCCTTGTTGTTTATTGGATT
CTTTTGTT

Sequences in the Contig:

SY0AAA52YO21FM1 SY0AAC18YB03FM1