Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3831
Length(NT) : 1351
Best Gene Model Blast : Link to GSTUMT00001501001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SS1G_11256
Accession: ref|XP_001588014.1| Score: 727 E_value: 5e-82
KEGG Definition: hypothetical protein
Accession: mgr:MGG_07481 Score: 643 E_value: 7e-75
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1059 Score: 573 E_value: 2e-59
PFAM Definition: Adaptin_N, Adaptin N terminal region. This family consists of the N terminal region of various alpha, beta and gamma subunits of the AP-1, AP-2 and AP-3 adaptor protein complexes. The adaptor protein (AP) complexes are involved in the formation of clathrin-coated pits and vesicles. The N-terminal region of the various adaptor proteins (APs) is constant by comparison to the C-terminal which is variable within members of the AP-2 family; and it has been proposed that this constant region interacts with another uniform component of the coated vesicles..
Pfam Number: pfam01602 Score: 271 E_value: 2e-24
Swissprot: Q865S1|AP3D1_BOVIN
Gene Ontology:
GO:0000139 = Cellular component: Golgi membrane

Sequence:
>Contig3831
TTGGCGGGCTAATATCTGGAGGCCTTCTGGCGGGTATTCAGGAAACTGGC
GAAGGGGAAGAACTGGCTTCCGTTTGCGTCACTAAACTCCGGGGGTTTTT
GGTGGAGGAGGATAGCAACCTAAAGTATGTAGGGTTACTGGCCCTGACGA
AGCTTGTAGCAACCCATGCGCACCTCGTCTCGATACACCAAGATGTGATC
CTGGACTGCATCGACGATGCGGATATTAGTATACGATATAGGGCGTTGGA
GTTGGTGGTTGGAATGGCCAACTCTGATAGCTTGCCAGGTGTTGTGGGAC
GTCTCATCCGCCAATTAAAGCCTAACACCAATCGCACCGAAGAGGAATTT
GTTGAGCCAGGGGCCACGTGTGGCGAAAGTGAAGACGAGGATATGGAGGA
AGAAGTCATGCACCCTCGGAGAGCCCGGGGGGAGGCCGTTCCCCTCGAAT
TACCCGAAGAGTACAAGCGAGCTGTTATAGCCAGCATCGTAGAAATGTGC
TCTCGGGATATGTATGCGAACGTTGGGGATTTTGGGTGGTATCTAGATGT
GTTAGTACAGTTAATAAGATATGCACCCACGGCTTCTACATCACCTCTAG
GGGATGAGGGCGATGAGGTGGAAGAGGAGGGCCAGGAAGAGAATGACAAG
CAGGATGTGGGCGAGGCCATTGGAAAGGAGCTCCGGAATGTCGCAGTGCG
GGTACGGAGTGTCCGAGGGGAAGCTGCTCGATATGCTGAAATGCTTGTTG
GGAAACGGGAAGGAATGTTTCCGGCCGCTGGCGGTGGTGGCCGCCGGGTA
CTAGGGGCAGCTGGTTGGATCGTAGGGGAATACGCAGGGCTACTTACCGA
GCCCAATGAAACCCTATCAGCACTCTTACACCCTTCGTCGTCATTACTAC
CAGCAGACATATTAGCTATCTATATCCAAGCGGTTCCGAAGATATATTCT
GTTCTTGCTGGGGCAGAAAATGCTCCATGGGCGCCACCTCGGAAATCCGC
AGTCGCATTACTGACAAGCAAGATTATCAAATTCTTAGAACCCCTTGCCA
TATCTCCTAATCTTGAAGTCCAGGAACGAGCCGTAGAGTTCCTTGAACTT
TTCAGACTAGCAGCGGAAGCAGTAGCCCAACAACCAGCTACAACTGAAGA
CGCTGATGAACAGTACGACGCTCCACTGCTCATCACCCAAGTTATCCCAG
GAATGGTTTCTCGGCTTTGAGCTAAACCCCGTCGCCCCCCGAGCTCAACG
GAAAGTGCCTCTACCAGCAGGCCTAGACCTTGACGAGCCAATCAATCCAT
ACCTCCAGCAACTGCTCTTAGAGTCTGAAAAAGACAGCTGTTTCGCCGGT
G

Sequences in the Contig:

SY0AAB53YE07FM1 SY0AAC18YA02FM1 SY0AAC45YH07FM1
SY0AAD12YJ17FM1