Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3830
Length(NT) : 1095
Best Gene Model Blast : Link to GSTUMT00002708001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_00877
Accession: ref|XP_001247106.1| Score: 844 E_value: 2e-88
KEGG Definition: hypothetical protein
Accession: yli:YALI0D19558g Score: 766 E_value: 1e-79
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG1237 Score: 436 E_value: 9e-44
PFAM Definition: PTR2, POT family. The POT (proton-dependent oligopeptide transport) family all appear to be proton dependent transporters..
Pfam Number: pfam00854 Score: 272 E_value: 9e-25
Swissprot: P32901|PTR2_YEAST
Gene Ontology:
GO:0005624 = Cellular component: membrane fraction
GO:0005886 = Cellular component: plasma membrane
GO:0042936 = Molecular function: dipeptide transporter activity
GO:0042937 = Molecular function: tripeptide transporter activity
GO:0042938 = Biological process: dipeptide transport
GO:0042939 = Biological process: tripeptide transport

Sequence:
>Contig3830
TTGGCTAGAACTCAAGATCGACTTCTGGGCAGCATACCTCCTTCCCTTCT
GCTTTCTCTTCGTTGGCTTCTTCACCCTCGTTGTCGGTCGCAAGAGTTAT
GTTGTCCGTCCGCCGAAGGGCTCAGTCCTTTTAGACGCGGGTAAAGCACT
AGGTATGGCTGCACGAAACGGCTTTCAGATGGACGCTGCAATCCCACAAT
TTGGCGAACAATTCATCAATGAACTTAAGCGCACACTTATCGCTTGCCGT
GTCTTCTGCTTCTACCCGGTGTACTGGCTTCTCTACGGCCAGATGAACAG
CAACTTCATCTCCATGGCCGGAACAATGGAAACCCACGGTCTCCCGAACG
ATCTCCTGTTCAACTTGAACCCCATATCCATCATCATCTTCATCCCTATC
ATGGAGAGCGGCGTGTACCCGTTCCTCCGCAAACTGAGAATCCCATTCAA
GCCGATCACCAGGATCACCTTCGGCTTCTTCCTAGCTGCCTCCTCGATGG
CATACGCTGCGGGGATCCAGCGCTGGATTTACAACACGAGCCCCTGCTTC
GACTTCCCGCTCTCCTGCCCAGCCTCAAGAGAAGGCGCACTCCCGAATAA
GGTGCACGTGGCGGCGCAAACACCGGCATACGTGCTCATCGGCCTCAGCG
AGATCTTCGCCTCCATAACGGGTCTCGAGTACGCCTTCACCAAAGCCCCG
CCATCAATGAAATCAGTCGTGATGGGAATCTTCCTTTTACAGAATGCCTT
CGGCTCCGCCATCGGAATCGCCATCTCACCCACTAGCAAGAACCCAAACC
TCGTCACCTTTTATGCTTGCATTGCTGGCGTTACTGCTCTTGCGGGCACT
GCCTTCTGGTTCTGTTTTAGGCATCATAATGCTACCGAGGAGGAACTTAA
CCAAATTGATGCGAATAATGAAGAATTCAAGCCCCGTCCCGCGGCTGATG
TTGAGACTGCGGTTGGCAGGTTTAGGAGTAGGAATTATTAAGTAGTTGGC
GTTATGCAACGATTGGGGGGGTTTTTCTTTTTCTTGCTTCGATGCGATGG
GATGTATGTAGCTATGATATTTGACAATTGAGAGGTGGTCTAGGG

Sequences in the Contig:

SY0AAC17YP15FM1 SY0AAD47YJ03FM1