Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3829
Length(NT) : 1171
Best Gene Model Blast : Link to GSTUMT00001457001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_04799
Accession: ref|XP_001556781.1| Score: 803 E_value: 1e-83
KEGG Definition: predicted protein
Accession: aor:AO090003000608 Score: 787 E_value: 4e-82
KOG Definition: No Hit Found
PFAM Definition: DUF1765, Protein of unknown function (DUF1765). This region represents a conserved region found in hypothetical proteins from fungi, mycetozoa and entamoebidae..
Pfam Number: pfam08578 Score: 362 E_value: 3e-35

Sequence:
>Contig3829
TTGGAAACCTTGCAATCGCTTGGGTTTACCACATTGGCTGCGACACTACG
GAGTATGAAGCAACCAGTGAAACCACCAGTTGGCATCCAAGTGGACTGGC
ACGGCGCGTGGACTAGCCGATGGAATGGTCGTGACTCGGACTTGTTATAT
GTTTTCTTGAAATACTACCACATCTTGATGTATGACTACCTGCCAGCGGA
TGTATCGCCACTAGCCAGGTTCACCGTTCCTGGCTATGTCATGGTGCAGG
CTCACATGCTATCACTGCTTGATAACACTATCCATCGCCAACCTCCACTA
ATGGGAGCTGATAATTTGGCATCGACAACCTTTGAGGACATGCTCGCTAA
TGCCACAGCCGCTCTTCCCATGACCGCTAGAAATCCCGCACGAACCATGG
CAGAAAATAAGATGGTGATACTTCTTCGGGATGTTATTTCTGATAAGGTC
AATTACTCGGAGGAATGTCGTATCATGTACATTACTTCTTTCATGGCCAT
GATCAGGGGAGCTGTTCGGAAGACACGTGTTTACGATGCCGATGCCTGTT
TCACTTTATGTGACTTGTTGGAGGAAATACTGCCTCTATTTTCACAAGCA
GAGAAGCTTTACAGCACGACTTTTGTGGATTGGCCGTTTTGGATGGATGT
CTTGAAACAAATGCTGGAGAGTGAGAATAATATGACTGAACTGCGGTTGA
TTTCGTTTGTCTATACTGCCTGGGATGTCATCGTGGAGGAGGAGGGGCGA
AAGCGGGCGATATGTCTGGGCTGGCTATTATCGGAGGCTGTTTGGGAAAA
ATATTTCTGCCATTGGTGCCCGATGGTTAGAGCATATTTCATGAGGTTGG
CCTGTTGGAGATTGGGCAGATGCGATGGGAACCCTAATCCGCTGGATCTG
GTCATTCTAGAAACCTTGCTTAGGCGGTTACGGACTGCGTATGCTCATTA
TCTGCGACTAAAGGACAAAGCAGAAGCGAACGGAACACCACTTCCGTCCA
CTGCTCCATGCCTTCCTCAGCCTTGCAGGCGACTATTCATTATCCGGAGC
GATGTCCTGACTACACCTCAAGGTGTTCTATTGGACGGAGTAATACCAAC
AGCTGCTCCGATATCCGACCCTGAGTCCTTGCCCAGGTTCAATTCTTCCA
TGTCATTGACCAGCATATCTA

Sequences in the Contig:

SY0AAB40YA05FM1 SY0AAC17YO18FM1