Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3828
Length(NT) : 900
Best Gene Model Blast : Link to GSTUMT00005788001 E-value : 1e-103
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3828
TTGGGGGGAGGAAGAGGAGGAGAACAAGAAGTGGTGGTGGTGTATTTACT
TCTCGATAATGCACTGACGAGAACCATCAAGAAATAATAATCCATGTCGC
CGCAATCGTGGACGTGAAATCCTCCTTCGGGGGGAAGCTTTCTCGTTTGG
ATGGGGTTCAACTGGTTGAGCACGATGCCTCAAGAAAACCCTTCGACTCG
ACAGGATGCTACCCGGGATCCGCCTTTAGCTTCTGGCCACTACGATGACT
GATCTCCGTCACCTAGGGAAATACCTCGCGGTTCTCACGATGATTTCCAC
CGGAGATGTTTGCAACAAGGCGAGATAAGACAAGGCCGATTAGTGGTAGT
TAGCTACCCGGATACCTTCTCCACGAAGGCATCGAAGCTTCTTCGGCCTA
GGAGGGCCGACGAAGGACGAGCACACGAGGTCTGGGTAATCTTATTAAGA
CTAGAATGGACTTTGACACGCGCATGCACACCGCAGAAACAACCCCCCCT
CTCCTTTCTCCCTGGGTCAATTGTTGACCAAGGAGGAAAACCGAGTCTCT
CGATCCCCGGCGGATTACTTGGTGTGAAGTAATGTATCGGGAAAAAACAG
GTTCACGATGAACGAAAAAGAAAAAGAAAAAAAAAAGGAAAAAAAGAAGA
GACAATGGGTTCCTTCCCAACCAAGGTGCTTCAGGGATTTCGCGATTCGA
GATATTTTTTTCACTCCTTTCCAACAATTTTCTCGAACGTACAAACTTTA
TGGACTTATCGGGGGAGAGATTCTCAATTCGTGCGTTCTGTGTTCGCCCC
GCCGGAGTTACTATTAGCGGCGGCATGCGTATCGCGAGTTCTGATCCAGG
ACTATCAGTTTTCTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC

Sequences in the Contig:

SY0AAC17YN14FM1 SY0AAC54YM09FM1 SY0AAC60YJ06FM1