Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3827
Length(NT) : 1165
Best Gene Model Blast : Link to GSTUMT00004005001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SNOG_05347
Accession: ref|XP_001795753.1| Score: 704 E_value: 3e-72
KEGG Definition: dual specificity phosphatase
Accession: aor:AO090023000868 Score: 682 E_value: 6e-70
KOG Definition:
Classification: [Defense mechanisms].
Kog Number: KOG1716 Score: 278 E_value: 2e-25
PFAM Definition: DSPc, Dual specificity phosphatase, catalytic domain. Ser/Thr and Tyr protein phosphatases. The enzyme's tertiary fold is highly similar to that of tyrosine-specific phosphatases, except for a "recognition" region..
Pfam Number: pfam00782 Score: 252 E_value: 2e-22
Swissprot: O13632|PVH1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig3827
TTGGCCAGAATTTCACTTAGGAAGAGCGTCCCAACTTACTTGCCTTAAGG
CCATCCGAGTCTTGTCATCCCGGTATCTTCAGCCTTATTTCACAGCCCAC
CTGACCAGCTGTCCTCGCTTGTTCTCTCCCCCCAACTACCTGCCGATTCA
TCGCTTTTTCCCTCTTAAACAAATAACCCCCATTATACAAGTACATGGTA
CTGCAGATGGACAAAGTGGGGGGCGAAAATCTTTATATTAGCGGAATGTA
CGCCTTGCGTGGGCGTGAAGCTCTCAAGAAAGCGGGGATTACCCATGTTG
TTTCCGTCTTGCGGTTGCCGTTGGATAAAGAATTATTCGTTCAATACCAG
CACAAGATCATCGAAGTGGACGATACCGAAGCTGAAAACATGCTGGAGCA
CTTCGCAGATAGTTACAAATTCATCTCCGATGCATTGAAAGGCGGGGGCG
CTGTCCTCATTCACTGTGCAATGGGCAAGTCACGGTCAGCGACAGTACTC
ACGGCTTACTTAATGGCATCACGCTGCCTTGCGCCACATCTTGCTCTTGG
TATCGTAAGGCGAGTTCGGCCTTTCGTCGAGCCTAATTCGGGCTTTATGC
AACAACTGGAACTCTACTATCAGATGGAATTTGCTGAAAATGTTGAGGAT
CACCCCATCTACCAACGTTGGATCTATCTGCGGGATGTAGAGATGAGCAA
TGCAGCCGGCCGTGCTCCGGAGAGAATCCACTTCCGGGATGCTGAGGCCG
ATACCGGGAGAATAACCAGAGTTAAGGAAGGTGAAACCCCCGAAGAGAAA
GGTGAGGTGCAGCTAAGGTGCAAGAAGTGTCGGACCGTTCTAGCATACTC
TGCCTCCTTCACACCTCATATGCCTAAACCTGCGCAGCCACCTTACAGTG
AGACACCCCTGCAGCCTTGCGCACACCATTTCGTTGAGCCTCTTCTTTGG
ATGAAAACGGAGCTTTCGAAGGGCGAAGTTTCCGGAAAGTTGGAGTGCCC
AAAATGCAACTCAAAGGTGGGGACATACGCATGGCAAGGCTTGAAGTGTT
CTTGCGGGGACTGGGTCGTCCCCGGCATCAGTATAGCTAGAGGGAAGGTC
GACGAGATCAGCTTAAAGCTATGAATGGGCCATTTAGGGGAAAAATTATT
TTGAACTTTAACATC

Sequences in the Contig:

SY0AAA58YM06FM1 SY0AAC17YN10FM1 SY0AAC19YO19FM1
SY0AAC19YO19RM1 SY0AAC53YF01FM1 SY0AAD21YA07FM1