Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3825
Length(NT) : 688
Best Gene Model Blast : Link to GSTUMT00011803001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein BC1G_03237
Accession: ref|XP_001558388.1| Score: 488 E_value: 2e-47
KEGG Definition: hypothetical protein
Accession: ncr:NCU07935.1 Score: 479 E_value: 9e-47
KOG Definition:
Classification: [General function prediction only, Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG4613 Score: 126 E_value: 5e-08
PFAM Definition: No Hit Found

Sequence:
>Contig3825
TTGGCTACTCTCGCTTTATCATAGACGATAGAATTACTATCACACTCGCT
CAATTTACAATCTCTCTATTTATTTCTTCCTTCTTGCAGCTTCCATAGTT
CGGCCCGAGAACAGCAATAGCAACAGTATTAATGTCCGACGGGCAACGCC
AAGCAAGATTCGATCATCCACCACTCACGCCCAGTCTTTGCTTCACCACC
GGCGCGTTAAAAGGATTCCTCCGCCTCTCGAGATCTTCAATAGACGACAA
TATAAGCCAAAACCTTAACGCCCTCTCCACACCCTCAAAACCAGCCTTTG
ATCCAACCACAACCTCAACCCCCTACCCAATAGCCCCTACCAGACACCTT
CCAGCGCAAACATGTCGTGCCTTTACAGAGCAAATCCTTCTCCCGTCATG
GCAGTCCCGCTCCGACGTCCTCAATTACTGCGCCGCTGTTGCCACGAGTG
ATGACCCTGACGACCCAGACTCAATCATTAGGCTTGTGGAGGGCATGGTG
GACAAGGAGCGTGTGGTGGATGAACGATTGGATCCTTATTCCGGGAGGTT
CTTTCCCAGGGAGAGCAGGACGGAGGTGCTTACCCGGGTTGTGCGCAACG
AGAGGATGGTGGAGAACATTGTTAGGGAGAGGACGTGGAGGATCGTCAAG
GAGAAGTGCGGCGAGTTTGGAGCTCTCGGGGAAGATTG

Sequences in the Contig:

SY0AAB52YE23FM1 SY0AAC17YN01FM1 SY0AAC59YF19FM1
SY0AAD21YI23FM1 SY0AAD24YG14FM1