Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3824
Length(NT) : 641
Best Gene Model Blast : Link to GSTUMT00010627001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein BC1G_08556
Accession: ref|XP_001553189.1| Score: 420 E_value: 1e-39
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00976 Score: 420 E_value: 5e-40
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1802 Score: 319 E_value: 2e-30
PFAM Definition: UPF1_Zn_bind, RNA helicase (UPF2 interacting domain). UPF1 is an essential RNA helicase that detects mRNAs containing premature stop codons and triggers their degradation. This domain contains 3 zinc binding motifs and forms interactions with another protein (UPF2) that is also involved nonsense-mediated mRNA decay (NMD)..
Pfam Number: pfam09416 Score: 361 E_value: 2e-35
Swissprot: Q9HEH1|RENT1_NEUCR

Sequence:
>Contig3824
TTGGCCTCTATAAAGAACAGAACACCCGGAAAATCCGATAACTAACGCTC
CACACACACCTTACAACTCCCTGCCGGAACTCAAGCCATTCGTTAAGACT
CTCTTGCTCCCAACTACGCTCTCGCCAAACGTGGGGCAAAATCTGGACTC
TAGGCAGCCCCACTTTAATTTGAGCAATCTTGCCAATATTTTGATATGGA
CGGTGTCTACACACATTTAGGAAATCATTTCGATGATACCGCATCAACAA
TTGACACTGCCTCCGTCTATGATCTTAAGGCCCGACGCCACGATGATGAT
GAGGAAACCGTCGATGAGACGTTGAGCCTAGCCAGTGTTCCCGTCGGCCG
TTCTGCTATTGGCGATAGAAATTACGGAGAAGAAACGGACGGGCTTGGAA
TTAATGATTCAAGAGATGCTGAGACTGAGCTGCCCGCACATGCTTGCGCA
TACTGTGGGATCCATTCCCCTTCCTGCGTGGTAAAATGTCTAGCTTGCAA
CAAATGGTTCTGCAGTGCTAGGGGCAACACCTCGTCGTCCCATATTATCA
ATCACCTTGTTCGTGCTCGCCATAAGGAAGTATCACTTCACCCCCAATCG
TCTCTTGGCGACACAACTCTGGAATGTTACAACTGTGGGAC

Sequences in the Contig:

SY0AAA15YE06FM1 SY0AAC17YM14FM1 SY0AAC62YJ05FM1
SY0AAD49YJ23FM1