Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3823
Length(NT) : 652
Best Gene Model Blast : Link to GSTUMT00005878001 E-value : 8e-43
Numbers of ESTs : 11

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3823
TTGGACCACCCTCTGGATGGTTAATTGTGGAAGACGAAATATACAAAAAG
GGTCAAAATTCCACTGTCTGTGTTGGGTTCGTTATTCAATTCAGTAACTT
GCCTGCCTAGGGAAAAAAATTGGCAGAACCCCCGCCTCCCCCCGTCGGCG
TACGAAAATACTTATCCCTTGCTGGACCACGAACCTACGAAACGGAAAAA
ATATTAAACCATACAAACTTCCCGCTCCCTTCGCCCGTCGGCCCCTTCTA
CCGTAGGCAGAGGGTTGAACTCCATTCGCTCCTACTGAACTACCTCCAAC
GCACGGCGCACTATACGCATACATGTACATAAGTACATACACACGGACAC
AGATAACACAGTCATTGCTGCTACAACTGCAGACTTAGAATATGCCGAGG
AGAAATAGATGCTCCTTGGTACTAGCTCTGCCACCCCGCCTTCCATCTTC
ACGCTCTTCTAGTGCTGGCCTTTCTTCCTCATCTCGGCCTTTCGACAACC
CTCTCCCTCAATTGCCTGCTCCCTGCACCGCTCCACTTCAACTGCTCCAT
CTACCACCTTCCGACATGAACCCTGTATCTCAGTCTGTTCCCTGTTTGCC
GACGGTATTTAAGTTAGGGCTCGTAACCCCAGATACCCCATCATTTCCCC
TT

Sequences in the Contig:

SY0AAA56YJ17FM1 SY0AAC17YM10FM1 SY0AAC40YF17FM1
SY0AAC40YH07FM1 SY0AAD15YI13FM1 SY0AAD22YG20FM1
SY0AAD25YM03FM1 SY0AAD40YF08FM1 SY0AAD48YJ07FM1
SY0AAD52YH18FM1 SY0AAD5YH22FM1