Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3822
Length(NT) : 1177
Best Gene Model Blast : Link to GSTUMT00007084001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: glycosyl hydrolase, putative
Accession: ref|XP_001257563.1| Score: 1095 E_value: 1e-117
KEGG Definition: beta-glucosidase, putative [EC:3.2.1.21]; K01188 beta-glucosidase
Accession: afm:AFUA_6G03570 Score: 1072 E_value: 1e-115
KOG Definition: No Hit Found
PFAM Definition: Glyco_hydro_3_C, Glycosyl hydrolase family 3 C terminal domain. This domain is involved in catalysis and may be involved in binding beta-glucan. This domain is found associated with pfam00933..
Pfam Number: pfam01915 Score: 499 E_value: 5e-51
Swissprot: P48825|BGL1_ASPAC
Gene Ontology:
GO:0008422 = Molecular function: beta-glucosidase activity

Sequence:
>Contig3822
TTGGGGTCTGGTTTGGGATGATCGGCTTTCTCTCATGGGTCCAAATTTCA
CTACGGCTGCTCTGAATAGCTCCGTACCTTTGGACAGAATTGACGATATG
GTTACTCGTATTGTTGCGACCTGGTATAAGTTTGGCCAAGATGATGGCCA
CCCAGAACCCAACTTTAGTTCATGGACCAAGAACACCACCGGTCTGTTGT
ACTATGGATCAAACGAGCCCCCATATGCCATCGTCAACAAACACGTTGAG
GCTCGCGGTGACCATGCGACTCTCGCGCGCAAGATTGCTGCCGAGGCTAT
TGCCATGTTGAAGAATGAGGACGTCCTCCCATTGCAGAAGCCAATGAAGG
TCGGCGTTTATGGAAGTGATGCTGGTCCAGGTGACGGACCTAACGCTTGC
CCCGACCGTGGATGCAATCAGGGCACCCTTGCCGTCGGGTGGGGAAGTGG
TGCCACAGATTTTGAGTACTTGATCACTCCTCTTGAAGCTATCGAAAAGC
AGGTTGGCACCTATGGGGGTCAAGTCTCTTCAGTCTTAAACAACACTAAG
CTTGACGAGATCAAGGCCGATGCTAAGAAGCAGGATATCTGTCTCGCTTT
TGTCAACGCTGATGCCGGCGAAGGCTATATCTCATGGCAAGATGTTAACG
GCGATAGGCCGAATCTCAAAACCCAGCTTGGGGGAGATGATTTGATCTCA
GCTGTTGCCGAGGCTTGCAAGGCCACTGTCGTTGTGGTTCACTCCGTCGG
CCCTATCATCATGGAGGACTGGGTTCGCTCTCACAAGGTTGACGGTATCC
TCTGGGCTCATTTGCCTGGCCAAGAAAGCGGAAACTCACTCGTCGATGTT
CTATGGGGTGCTGTTAACCCTAGTGGAAAGTTGCCGTACACCATCGGAAA
GAGCTTGGAAGACTACGGACCAACTGCAGGTGTCCTCTACGAGTCCAACG
GAAACCCGCCACAACAGGACTTCACTGAAGGTTTGTTGATTGACTACCGC
TACTTCGATAAGAAGGATATCACCCCTCGCTATGAGTTTGGTTTCGGCAT
GTCTTATACCACCTTCGAGTTCAGCGATCTCAACATTGTCCGCACCGGAT
CGATGGAGCCTCTTCCTAAGCCTCGCCCTGCTCCCGAAGTTACTCCTCCA
ACCTACAATTCCACGCTCCCTCATCCT

Sequences in the Contig:

SY0AAB9YJ07FM1 SY0AAC17YM07FM1