Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3821
Length(NT) : 746
Best Gene Model Blast : Link to GSTUMT00004848001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: Vps34p
Accession: gb|ABO31328.1| Score: 767 E_value: 8e-80
KEGG Definition: phosphatidylinositol 3-kinase VPS34, involved in signal transduction [EC:2.7.1.137]; K00914 phosphatidylinositol 3-kinase
Accession: aor:AO090020000426 Score: 766 E_value: 5e-80
KOG Definition:
Classification: [Signal transduction mechanisms, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0906 Score: 769 E_value: 1e-82
PFAM Definition: PI3_PI4_kinase, Phosphatidylinositol 3- and 4-kinase. Some members of this family probably do not have lipid kinase activity and are protein kinases..
Pfam Number: pfam00454 Score: 353 E_value: 2e-34
Swissprot: P50520|VPS34_SCHPO
Gene Ontology:
GO:0005942 = Cellular component: phosphoinositide 3-kinase complex
GO:0016303 = Molecular function: 1-phosphatidylinositol-3-kinase activity
GO:0030476 = Biological process: ascospore wall assembly
GO:0046488 = Biological process: phosphatidylinositol metabolic process
GO:0031321 = Biological process: ascospore-type prospore formation
GO:0008104 = Biological process: protein localization
GO:0007033 = Biological process: vacuole organization and biogenesis
GO:0016192 = Biological process: vesicle-mediated transport

Sequence:
>Contig3821
TTGGGTCGAACAATCCGGACCCCACGCAGGAATATGGAGTGAGGGCGGAA
GTGATGGATACGTATGTCAAGAGTTGCGCTGGGTATTGCGTAATTACGTA
TATCCTGGGTGTCGGAGATCGGCATTTAGATAATCTTCTATTGACACCTG
ATGGCCACTTCTTCCACGCTGACTTTGGCTTCATCCTCGGCCGAGACCCA
AAGCCCTTCGCGCCCGCCATGAAACTTTGCAAAGAAATGGTGGACGGGAT
GGGCGGTGCGAATTCCCGGCACTACATTGAATTTAAGAACTACTGCTACA
CGGCGTACACCACGCTGCGCAAGTCTTCGAACTTGATACTCAATCTGTTC
GCGCTGATGGTCGACGCCAACATTCCGGATATCCGGTTGGAGCCTGATAA
GGCGGTGCTGAAAGTTAAGGATAGGTTTTGTCTGGAGATGACGGAGGAAG
ATGCCATCAAGCATTTTAGAATTTTGATCGATAATAGCATGAACAGTGTT
TTGCCAGTGCTGATTGATAGGATACATGTTCTCGCGCAGATTTGGAGGAC
GTAATTTGGATGGGAGTTGGGGGGTTGTTAGGAGATCTTGCGAGTGTTGA
GATACCTCCTTGTATGATATATATGTTATAAATTCTCTCTCTCGGTCAAG
GGATCCTAGCCTGCAGACAACTTGGAAGAAAGGGAAAAGAAAAGGAAATC
CAACAGCGTATCTGGTATCACAATCTAGGTTTATGCTGGCTGTGAT

Sequences in the Contig:

SY0AAA61YA17FM1 SY0AAC17YM03FM1 SY0AAC26YO05RM1