Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3820
Length(NT) : 1477
Best Gene Model Blast : Link to GSTUMT00003188001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein FG06439.1
Accession: ref|XP_386615.1| Score: 137 E_value: 3e-06
KEGG Definition: hypothetical protein
Accession: fgr:FG06439.1 Score: 137 E_value: 1e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3820
TTGGCGGTGACGAGGGAATGTTCTCAGTGCTCGCGGCATGGGCATGATAC
CCGTATTCTCACGTTCTATCTATCTTCCCGGACCTACGGGCCTTTCCAGG
AATAGAAGCTAATCTACCATATCCCGAGCAGTTACTGCACTTCAGTCAAC
CGAATACTTCGCTGCGAGTACAGTACCGCACAAGTACTTGAGTACGGTAC
AAGTGAGATACTCGGGAGCTGAGTGGTTTGACAGATACCAGTACGGCTCC
TAGGGGAGTTTGCATCTGCAGCAAAAGCATATTCCAGCAGTCAATCATCC
TTCCACCAAACGGAGACGCACTCTGCTTAAGCAATCATATCTGACCACCG
CCATTGGGGGGGAGGAGGAAAGAATTCTTCACCATCCTAAGACGGATTAT
CTCATCTGCACGGTAATGCACTGTCACTCGAGTACGGTAGGTCAGGTGGC
TTGGAAATTACCAACGCTTAACCTGATAAAGATAGGTTATTTGGGTGCCG
AGTTTCTATCTTTAGTTTGTCATAGCATACTCGAGTAGTAAAATATAACC
CAGAGGTGCTTGAAAGGCTGGGATGAAAAGAAGGTTATGACATGATACCG
GTACCCCCTTGTTCCATCGTCCGTCTTATATGCCGCTTATTATTATGCTC
GGAAAGGCAAGCCAGGCGCATGCAGAAGCGCTCGAGCAGGCTGGATATCG
TGCCTCTGCTTCTCGAAGGTGGAGGAAGCTCTTTTTTGCGGGGAAATCTT
TTGCCTGTGGTGGTTGGGGTGGGGATGGTCTGGGAGGACCTCTCATATAA
GGAAGCGAGCATTTCCGTCAACGGTTTCGGTATTCAGAATCATTTAATTA
GCGGCTTAAAACACTAGAACTGGGTTTAGATTGCTATTCTACTATCACTG
CTACACTCTTTACTACTTTTAACTTTTAATATGTCCCAACAACCCCCCCG
CGTTGATGTTCCGGTCTCCACTGAGGGCCTTTTGGCGCTCACTTGGGGAT
TAAACTCTCTTGTTTTCGTCGTCCTGGTCATTAGACTGGTGCTTCACAGA
AGGCAAAAGTTGAAAGGTCCCGCAATCGTCATTTCCGATGCCCTGATCTG
CGTTTCTTTCTTTTTCGGAATAACAGCCATCGCGACGGATGCATGGAAGT
ACTCCAAGGAGATTGAAGCCAGGACTCGCCAATTGTCACTTCACGATAAG
GAAACTTCTCCGAAGCTCTCCTTCTTTTGCGGCTACTTCGTCTTCTCAGC
AATGTGGTTCGCCAAAGGCGCCTTCGTAGTCTACTACTACCACCTTTTCA
CAAATCTCTCCAAAAAGCTGAGATACTATCTCATATTTGTAACTGCCTTC
ACCGCGAGTACCTACATTTTCACTATGCTCCTACAAACATTCTGGTGCCG
TCCCATTTGGACAAACTGGACTCTCGACCCGCTCCGCGGCTGCTCGGCCA
CGGGGAACACCACCACTCTCCCGCTCT

Sequences in the Contig:

SY0AAC17YL20FM1 SY0AAC18YD14FM1 SY0AAC40YJ04FM1
SY0AAD46YN19FM1