Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig382
Length(NT) : 724
Best Gene Model Blast : Link to GSTUMT00002297001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CHGG_03424
Accession: ref|XP_001229940.1| Score: 194 E_value: 2e-13
KEGG Definition: hypothetical protein
Accession: fgr:FG03078.1 Score: 170 E_value: 6e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig382
TTGGCTAGTATCGTCTAATCCGATACTACGCTTCTATTTCTTCTCCGCCA
CCTCTATTCAAACCTTCATCCCTAGTTTTCGCATCTCAAACCCCTCTCCT
GGATCACGGGCGAACGAAAATAACCGACATGAGCTCAAGCTCTCCCCCAC
CAAATAATCCCACCCTAACCCTACTTGTGGAACCCGATGGCGTAGGCGAT
TTCGAAAGGCACAGCGTAGACGTGGTTGTGGTCCACGGGTTGAATGGAGA
TTACAAGAAAACTTGGGCCCACGGTCAGGAACCGCCGTGGATCTCCACCG
CTCTCCCGAAGGCTGTGCCTAAGGCCAGGGTTATGTCGTTCGATTACAAC
GCAACTACAGAGCCTGAAACCGGCATTGCCGATCCGGAGGGCCTTCGCCG
GATTGCCTATGAACTACTTTCACAGATAAAGGGACTTCGGCAATATCCTA
ACGCGTTTGACGAGGTTTGCCCGATGCCACTCGGATCGGAGAGGATGGAC
GATGTCTAATGACAGTATCTACAGAACGTTCCTATCATCTTTGTTGGCCA
TTGCCTCGGCGGCGTTTTGATCCAGGAGCTACTTTGGGTCGCAAACCACG
ACCTGGACTACTTAAGGATCGCTGCCCGTACAAGGCTGTTAGTGCTTTTC
GGTACTCCGGAGGTGTCGGGGAAGGAATGGGAAGACGTGGTTCTGAATAC
CACCCTAGCAACCACCGAATCCGA

Sequences in the Contig:

SY0AAA22YH06FM1 SY0AAC35YB22FM1