Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3819
Length(NT) : 3283
Best Gene Model Blast : Link to GSTUMT00000475001 E-value : 0.0
Numbers of ESTs : 20

Blast Results:

Nr Definition: hypothetical protein BC1G_07936
Accession: ref|XP_001553743.1| Score: 827 E_value: 7e-86
KEGG Definition: hypothetical protein
Accession: ncr:NCU00499.1 Score: 820 E_value: 2e-85
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0161 Score: 145 E_value: 2e-09
PFAM Definition: ERM, Ezrin/radixin/moesin family. This family of proteins contain a band 4.1 domain (pfam00373), at their amino terminus. This family represents the rest of these proteins..
Pfam Number: pfam00769 Score: 120 E_value: 1e-06
Swissprot: P22793|TRHY_SHEEP

Sequence:
>Contig3819
TTGGGCGGATTTTCTCTTGCTCGTTTTTCCTTCCCAGATAGTTAAGCAAA
CGTGAATTAAAGTCGACCCATTTGTCTGTACAGACTGTCGTCCCCAACAA
GATTATATTCGAATACATTATTTTCCTTTTTTTGCAATAAACCTCCAGCA
AACTCGTACTTCTCCATTTTAAACGGAGTACTGTACCCGTATTTACTGTT
TTTTACCTTTTCTAGATTTCCCCATAACCTTACCCTGTTACCACTACCCC
ACTACTCTCTCTTCCCCCTAGCATTTATACACAACCCGAACAATAATGGC
AGCTTCGGCATACCACTACAACAACATGGATCACTACATTCAGCAGAATA
ACCTCTCCCTTGATACACGGCGGGGGCAGCAGTGGTTAGACGATGACGAG
TCGTCAATACTAGACGATAACATACTCGACAACAACAACCTCCTCGACTC
TGCCCTCGATATGTCCCCCATCGACCGACGACGACCTTCTCTCCTTGAAA
CCAATGCTATCTTTTCCCCATCAAACGACTGGGACTTTGAAGATCATGAT
ATGGGTCTGTCTGCGGGTCCAGCAGACGATAACTCACCAGTGCCGGCAGC
AACTTTCGAACACAGCAACGGAACAAACAACCCATTCATTAAACTTGAGC
AGGCTCAGCCCGCGTTCGCCCAGCAGAACGGCTCGTGGTCATCTAATCAT
GGTGCATCGGGTTCGTGCACTCCTACCGTGTACGACAACAATGCTTTCCC
TAACACAGCTTTCGAAGATGGCTCAGCATATCTGGCTCCTGCTATCGGCG
GTGCTGGCCCGGCTGGTGCTTTTGGTAGTGACATTCACATCACCCCTCAT
GCCACAGTATTCCAGGGTGCTGGTGCGGTTTCTTCCATTCCTTCGACGCC
AGCTCAGAAGGATTGGGCGCAGGCTTCGGGTGCTGAGGGTCACGATTCGC
AGCCCATGCAGAAGAGGATGAGGCCACAGAGCCCCGCTCCCCGTGCTCAC
TCCCCCCTACATGTTATGCGACGAGATGGGATCCGAAAGAAGAATGCTCG
CTTCGATATCCCGGCCGAGAGGACTTTGATGAACATTGACCAGTTGATTG
CGCGGTCTCAAGATGATAACGAGATCAAGGAGTTGAAGCAACAAAAGCGG
TTACTCAGGAACCGACAAGCTGCTCTCGACTCACGGCAGCGAAAGAAGCA
GCACACTGAGCGTTTGGAGGAGGAGAAGAAGATCCACAGTGCTGTTATCC
AAGAGCTTGAGGACAAGCTTAACGCCATGTCGATGCAGGAGGAGCAGATG
CACCAGCGAATGGAGAACCTGATCCGGGAACGTGAATTCCTTGCCCACAA
GGCTGAGACACTTCAGATGGAGAAGGAGGATATTGTTCGCGAGCATACCA
TCGAGACCCGTGAACTTCGCAAGAAGAACACTTACCTCGAGGGTCAAGTC
CAGAAGATGCAGGAGGCTCTTGACCGTGCCCCTATGGCCCATGCCCCCAG
CTCATCTGGATTCAGCGACGGCTTCAACCTCGATTCGGACTTCGATCTCG
AAGCAGACTACTGGAATAACGACCTGTCCCTGCAGTCTTCCGACATCGCC
CCAATCAAGTCAGAGAAGATCCAGCCACGTGATGCTGAAAAGCCAGCTGC
CGCTCCCGGTCTGTTGCTTATTCTTCTTTTGTGTGGTGCATTTGTTGCTT
CTTCCAAGACTTCTGTTCCCTCACTTCCGCCATTCCCTAAACAATTGCAA
TCTGCCTCAGCAGATGTTTTGAACAACATCTTCCAGGATGCTGGTGTTAC
CCCAATGGAAGCTAGCCGTGTTGAGGCAGCTGATGTTTCTTCCACCTCCG
ACACATGGATAGTTGCGAAATCATCAGTACCCCAGATGGTTGGACTTGAC
TCTTCTTTGGCGATGTTGAACGCTCAATTGGACAAACCCTCGGCTGAACA
GCAACACGAATCATTCATGCAGCTGACAGCTGCTGAATACAACGATGTCA
CCTCGAACAACTTTCTCCGCGATCCCGAACCAGTCGCTCGAAACCGGCGC
CACTTGGAAGAAGGCCTTGCCTCCATGCGAAGCAAGCCTACTGCCGCTGA
TGTCTACACTCGTTCGCTTCTTTGGGATAAGGTTGATGCCGAGGTTGTCC
GTCGCTTTGCTGCTTTTGCCCAGCGTGCTCAAGCTCAACAGGCTCGACAA
GCTTCCTCCAACGACTGCGAGCCCAGTGGATATGGCGATAGCGCCGTATA
AACTTATTTCCTTACCCCCTTTCTCCTCCCCCGATCAACAAAATATGGAG
ACTTTGAGACCCACACAAACGCACTTGACGCCATTGTCTCTTTCCTTGCG
TATTGCTTCCCTATATTTTTATAAGGGACTGGATTCATGGAATCCCACCT
TCTCATCACCGCCCCTCCGTGATCTACATGGACCGACGCTTGATCGACTG
GGTCTTCACCCACATGCTTGAGATTTCATTTGTTTTTATATCCTGTGCTT
TACACCCTTCCCCAGTTGTCTGTACGCAGACGTTGCGGGTCGGATGGGCC
ACCGACATTATACACCTGCAATACTTTTCTTTTGTCTTAAAACAGCTTTT
ATTGATCGTTATATGTGGTGTGTTCTTATCTGTCCCCCTCTATTTTACCC
CCCATCGGGCGGCTTCGTGTGACGTGTTTATATGTGGAGATATTATGATG
AAAACGTTGGGTGGTGGTTTTCGATGATTGATTGAATCATTTGGGAGGCT
TTGGAAGTCTTCTTTTTTCTTTTCGGGGAGGCTCCTCAACGGACCCGGGC
TGGCATAGCGGTTGTTTTTTATCTGCTTGGTTTTTTTTTGAAATTTGCCT
TTTGATTTTTAGTTTTGCGTTGATTTTTCTTAGCTCCTGTTTTTCGTTTG
AGCATTTTGGTTTGGTTTGATTTTGATTTTTTTTGTTCAAAAACTCTTTC
CTCGCATACATTCTCCACGGTATAATATTTTTTTTTCATTTTTTGATAAG
GATATATATACCTGTGGCGGGTTTCCCAGGTTGGTCACCGTCTCCTTTGC
GGCGGCCTTTTTGAGTTTTTTTGCTTTATTGTTTTTTGCTTGCAGCGGTT
TTTTGAGCTCAGTTTTTTTTTTTTCCATCTCATATTTTGTAAATTCGTCT
AGGGCACCTTAGGTTTGGAAATGGTTGGTTTTCTTTTTTTCTTTCTTCCT
CCTGCCTAGCCTTGTTTTGCCTTGTTTGTTTTTTGCCCTGCTTTTTTTTT
TCTTTTCCCCCAATCTTGAAGGTGACGAAGTTA

Sequences in the Contig:

SY0AAA13YE21FM1 SY0AAA25YM15FM1 SY0AAA39YL21FM1
SY0AAA42YM17FM1 SY0AAA44YO06FM1 SY0AAA46YK04FM1
SY0AAA53YF21FM1 SY0AAA63YH20FM1 SY0AAB1YO13FM1
SY0AAB28YH13FM1 SY0AAB29YE05FM1 SY0AAB46YD14FM1
SY0AAB49YO01FM1 SY0AAB6YN23FM1 SY0AAC17YK12FM1
SY0AAC2YM03FM1 SY0AAC4YP23FM1 SY0AAC53YJ13FM1
SY0AAD12YM24FM1 SY0AAD20YO18FM1