Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3818
Length(NT) : 916
Best Gene Model Blast : Link to GSTUMT00009232001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein An17g00720
Accession: ref|XP_001398301.1| Score: 524 E_value: 2e-51
KEGG Definition: hypothetical protein
Accession: ang:An17g00720 Score: 524 E_value: 9e-52
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG1159 Score: 569 E_value: 3e-59
PFAM Definition: Flavodoxin_1, Flavodoxin..
Pfam Number: pfam00258 Score: 275 E_value: 3e-25
Swissprot: Q4WU59|TAH18_ASPFU

Sequence:
>Contig3818
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAACAAAAGCTCCGCCACCA
CCAACGACGATCCACCATTTATTTTTGTTACGAACCATCTTCGATCCCCC
TAACTCCGCAAATCCTAATGGCAGGTTCCTTGTTGGCTGGTTCCCCAGTT
CTAATTCTCTACGCCTCTGAATTGGGGACTGCCGCCGATTTAGCCAAGGA
GGTTGCCCATACTCTCCTTCGTCGTCGACTCAATGTTAAGTGCATGGAAG
CAAACGAGCTCGACCCGTTCACTTCTTTGCCCATCTACAAGACCATAATT
TTCCTTGCCTCTACTACTGGTCAAGGTGAGATTCCAATGAATGGAAAAGA
CTTTTGGAGGAAGTTCCTAGTGAAACGTATTCCACGGGATTGGCTTAAAG
GTGTCGAGTTCACGACATTTGGTTGTGGCGATAGTACATATCTGAAGTAC
AATGCGGCTGCGAGGAAAATTCATGGTAGATTTTTACAGCTCGGCGCTAC
ACAAATGGTCGCAAGAGGCGAAGGCGATGAGCAGCATAGTGAGGGGATTG
ATGGCTCGTTTTTCCCATGGTTGGAGATGCTTGTCGACACTTTATCCATG
AAATACCCTCTCCCAGACGGGGTCGAGCCTCTGCCTGCGGACCACTTGCT
GGAGCCCGAACACTTTGTGACTCTCACAAGCCACCGCAAGGTCACTTATC
TAGTTCGAGATGTCATGAAAGACCTCCACGTCCAGCGTCCAGCCTCTAGA
ACGTGTCTTATTGTTAGAAACAAGCGGGTTACGGCAGAATCGCACTGGCA
GGATGTAAGACACATCACTATTAGCGTACCGGGATCTAGCGTAAGATGGG
CACCTGGAGACACGGTGACTCTTCTACCAAAGAATTTTCCTGAAGACGTA
GAAGAATTTTTGGTCT

Sequences in the Contig:

SY0AAC17YK06FM1 SY0AAC35YC07FM1 SY0AAC48YO06FM1
SY0AAD53YD07FM1