Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3817
Length(NT) : 761
Best Gene Model Blast : Link to GSTUMT00007052001 E-value : 1e-121
Numbers of ESTs : 159

Blast Results:

Nr Definition: hypothetical protein SS1G_02202
Accession: ref|XP_001595986.1| Score: 706 E_value: 1e-72
KEGG Definition: hypothetical protein
Accession: ang:An11g02620 Score: 660 E_value: 1e-67
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0258 Score: 741 E_value: 3e-79
PFAM Definition: Aminotran_1_2, Aminotransferase class I and II..
Pfam Number: pfam00155 Score: 141 E_value: 8e-10
Swissprot: P52893|ALAM_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig3817
TTGGGGGGACAACTTTGTACATTGGGGATTGGGTTGAAGCCTAGAAGTCA
AGTCGCCTCCGCAAGCAGTCTTAAATATGTCTACTTCATCTCCTCGCAAA
GCTTTAAACATCAAGAACATCAACCCTCACATCCTCAAAGCTCAGTATGC
CGTCCGTGGCGAGCTTGCCCAACGTTCCGAAGTGTGCCGCCAACAACTTG
CTGCCGGCGACGCCAAACTACCTTTCGATTCTGTCATTTCAGCAAACATT
GGAAACCCGCAGCAGCTGGGCCAAAAACCCATTACCTTTTTCCGTCAGGT
TCTGAGTATACTAGAGTACCCGGCCCTGTTGGAGAAGGAAGGATTATTCC
CTGAGGATGTTCGAGAGAGAGCGAGGGTTCTCCTGAAGGAGGTGGGAAGC
GTTGGCGCTTATTCTCAGAGTCAAGGATGTTTGGGAATTAGGCGGAGCGT
TGCAAAGTTTATTGAAGCTCGTGACGGACACCCCGCGGACCCTCGCGATA
TCTTCTTGACAGCCGGAGCCTCCTCTGGGGTCAACACCCTTTTAAACACC
ATCTGCTCGCATCCCGCCACCGGGGTGTTGATTCCAATCCCCCAATATCC
GCTTTACACCGCTACTCTTGCTCTCCTCAACGCCACTCCGGTCCCTTATT
TTTTGGACGAAGCTACTGCATGGTCCACCGATGCCAAACAGATTCGCTCC
GAGATTTCAAAGGCCAAGGCAGCTGCTATTGATCTTAAATGCCTCGTTGT
AATCAACCCGG

Sequences in the Contig:

SY0AAA12YL09FM1 SY0AAA13YI18FM1 SY0AAA22YL03FM1
SY0AAA39YD08FM1 SY0AAA52YB02FM1 SY0AAB14YB06FM1
SY0AAB51YM16FM1 SY0AAB61YJ17FM1 SY0AAB7YA18FM1
SY0AAC10YJ09FM1 SY0AAC11YA03FM1 SY0AAC11YD20FM1
SY0AAC11YH22FM1 SY0AAC13YG15FM1 SY0AAC13YM06FM1
SY0AAC14YC01FM1 SY0AAC14YI11FM1 SY0AAC14YL14FM1
SY0AAC14YP04FM1 SY0AAC15YE06FM1 SY0AAC16YK03FM1
SY0AAC17YJ21FM1 SY0AAC18YJ02FM1 SY0AAC18YP11FM1
SY0AAC19YH15FM1 SY0AAC19YL03FM1 SY0AAC20YF21FM1
SY0AAC20YO20FM1 SY0AAC20YO23FM1 SY0AAC21YH08FM1
SY0AAC23YK04FM1 SY0AAC23YN10FM1 SY0AAC24YE16FM1
SY0AAC27YK06FM1 SY0AAC28YO14FM1 SY0AAC29YE13FM1
SY0AAC2YB01FM1 SY0AAC2YG24FM1 SY0AAC30YG19FM1
SY0AAC30YJ19FM1 SY0AAC30YJ24FM1 SY0AAC31YO08FM1
SY0AAC33YI17FM1 SY0AAC34YI21FM1 SY0AAC36YD11FM1
SY0AAC37YC02FM1 SY0AAC39YK17FM1 SY0AAC40YC04FM1
SY0AAC40YG17FM1 SY0AAC40YP18FM1 SY0AAC43YJ17FM1
SY0AAC44YM17FM1 SY0AAC44YP23FM1 SY0AAC46YA07FM1
SY0AAC46YB17FM1 SY0AAC46YD10FM1 SY0AAC46YE09FM1
SY0AAC46YN06FM1 SY0AAC46YO05FM1 SY0AAC47YB03FM1
SY0AAC48YF08FM1 SY0AAC48YG15FM1 SY0AAC48YO01FM1
SY0AAC49YC14FM1 SY0AAC50YL12FM1 SY0AAC51YD07FM1
SY0AAC51YK11FM1 SY0AAC52YG11FM1 SY0AAC52YO01FM1
SY0AAC54YC12FM1 SY0AAC54YH01FM1 SY0AAC54YI02FM1
SY0AAC54YK14FM1 SY0AAC54YN06FM1 SY0AAC55YB23FM2
SY0AAC55YO04FM3 SY0AAC56YE10FM1 SY0AAC56YK21FM1
SY0AAC57YC05FM1 SY0AAC57YF13FM1 SY0AAC57YK13FM1
SY0AAC5YC03FM1 SY0AAC60YF09FM1 SY0AAC60YM23FM1
SY0AAC61YD04FM1 SY0AAC61YL09FM1 SY0AAC62YG09FM1
SY0AAC6YB02FM1 SY0AAC6YB05FM1 SY0AAC6YJ15FM1
SY0AAC6YM06FM1 SY0AAC7YG07FM1 SY0AAC9YP23FM1
SY0AAD10YA21FM1 SY0AAD11YE13FM1 SY0AAD11YP05FM1
SY0AAD11YP17FM1 SY0AAD12YA12FM1 SY0AAD12YD14FM1
SY0AAD12YD22FM1 SY0AAD15YC23FM1 SY0AAD16YC18FM1
SY0AAD16YH03FM1 SY0AAD1YO02FM1 SY0AAD21YD16FM1
SY0AAD23YC22FM1 SY0AAD24YD19FM1 SY0AAD25YJ17FM1
SY0AAD27YB19FM1 SY0AAD27YI14FM1 SY0AAD29YE24FM1
SY0AAD29YL17FM1 SY0AAD30YA15FM1 SY0AAD33YH18FM1
SY0AAD33YM22FM1 SY0AAD34YF22FM1 SY0AAD34YJ09FM1
SY0AAD35YA24FM1 SY0AAD35YE07FM1 SY0AAD35YJ23FM1
SY0AAD36YN15FM1 SY0AAD38YC02FM1 SY0AAD38YI17FM1
SY0AAD38YN24FM1 SY0AAD39YN19FM1 SY0AAD40YH04FM1
SY0AAD40YI12FM1 SY0AAD40YL01FM1 SY0AAD41YE14FM1
SY0AAD41YE24FM1 SY0AAD43YI07FM1 SY0AAD43YM16FM1
SY0AAD46YC03FM1 SY0AAD46YN24FM1 SY0AAD47YP08FM1
SY0AAD49YC12FM1 SY0AAD49YD03FM1 SY0AAD50YC21FM1
SY0AAD51YG17FM1 SY0AAD53YM23FM1 SY0AAD56YE13FM1
SY0AAD57YI22FM1 SY0AAD57YL20FM1 SY0AAD57YM14FM1
SY0AAD59YK23FM1 SY0AAD5YL01FM1 SY0AAD61YK13FM1
SY0AAD61YL19FM1 SY0AAD61YM04FM1 SY0AAD61YP02FM1
SY0AAD62YA23FM1 SY0AAD62YE03FM1 SY0AAD62YP07FM1
SY0AAD63YJ16FM1 SY0AAD6YJ04FM1 SY0AAD7YI06FM1
SY0AAD7YM16FM1 SY0AAD8YA14FM1 SY0AAD9YJ08FM1