Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3816
Length(NT) : 2058
Best Gene Model Blast : Link to GSTUMT00009562001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: DNA mismatch repair protein Msh4, putative
Accession: ref|XP_001265451.1| Score: 1061 E_value: 1e-113
KEGG Definition: DNA mismatch repair protein Msh4, putative
Accession: afm:AFUA_1G02000 Score: 1021 E_value: 1e-109
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG0220 Score: 774 E_value: 1e-82
PFAM Definition: MutS_V, MutS domain V. This domain is found in proteins of the MutS family (DNA mismatch repair proteins) and is found associated with pfam01624, pfam05188, pfam05192 and pfam05190. The mutS family of proteins is named after the Salmonella typhimurium MutS protein involved in mismatch repair; other members of the family included the eukaryotic MSH 1,2,3, 4,5 and 6 proteins. These have various roles in DNA repair and recombination. Human MSH has been implicated in non-polyposis colorectal carcinoma (HNPCC) and is a mismatch binding protein. The aligned region corresponds with domain V of Thermus aquaticus MutS as characterised in, which contains a Walker A motif, and is structurally similar to the ATPase domain of ABC transporters..
Pfam Number: pfam00488 Score: 269 E_value: 4e-24
Swissprot: O15457|MSH4_HUMAN
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0003677 = Molecular function: DNA binding
GO:0007131 = Biological process: meiotic recombination

Sequence:
>Contig3816
TTGGCCCCTCTTCTTCAAACAAAATGCCTAGACCCTCAACGAGTTCTTCG
GGAACCTCTTGCCCTCCTACGTCAACCAGTCGTCCTAGAACTTCGCGACC
AAGGACTGCTACCTCTGCAGCTGGAGGGGGAGCTCAGCAGGTTGTTTGTG
CTGTTACGGAGTCTCGTGGAGTATCGGCTACCATCGGGTTGTGCTTTGTG
AATACTGCTACTGGTGAATGCGTATTGAGTGAGATCTGTGATACACAAAC
ATATGTCAGGACAATGCAGAAATTGACTGTGTTTGACCCGACTGAGATTC
TTGTTTCTCCCGCTGCTGTTGCGCCTCCAAAATCGACTCTTTTGTCTATT
ATTGAGGATTATGTTCCTGGTGCGACGATCACGGAAGTTCCCAGGAGATA
CTTCAATGAACGGAGTGGTCATGATTATATCCAGCAATTGGCTTTCCCAG
ATGAGGTCACCGGCATCAAGGTTGCCATTTCTGGGAAGTTCTATGCTATA
TCTGCTGCGGCGGCGGCATTGAAACATATCGAGGTTTCTTACATAAGATT
CGCCTTGCATTCCCTGAGAATCAAATACCAAGGAAGTGAAGTACGGTCCA
CAGTCTTGAGCTCATACAGAATATCCAGGACCCAAAGTCTACTGAGTGCC
TTTTCGGGCTATTGGATAATACCCTCACAGCCATGGGAGCGCGGCTGCTT
CGGGCCAGCATTCTGCAGCCTCTGACCGACCTCTCCACACTAAATGCAAG
GCTTGATGCCGTAGAGGAGTTTACCCAACACGAGGAGATGTTTTCCCAAG
CAAGACAGGCATTGAAACCATTTCTTGACATGGACAGACTTCTCACTGCG
GTATTGCTTGGCAGGATTTTTTTCCCTTCCTTTTCCCTTTCGGGCTTCGG
ATCACCAGTACGTGAACTGACCATCACAGCTTATCACCATGCCGGTCAAA
CCTAGTTTGAAACACTCTGAGCAGGCGATCAACAATATCATCATACTGAA
GCAATCGCTATCGTCCATTGCGCCGGTCTACGATAGCCTTGGCTCTGCCA
GAAGCTGGCTGCTAGTTTCCATTCGTAATCTTTGTGATTCAGACCAGATC
GAACCGGTCCAGAACCTGATCAGCAGTATTATAAACGAAGATGTGGTCTT
TTCCAAGAGTCCATTGGACCTTCGTAACCAGAGATGCTATGCGGTAAAGA
GTGGTGTGAACGGATTACTTGATGTTGCTAGGCAGGTTTACAAGGAAGTC
ACCGAGGACATGCACCAATTGGTCGAAGACATATCTAAAGAGTATGATCT
GCCTCTAGAGCTGAAATTCGAGACTGGGAGAGGCTACTATTTGCGCCTCC
CCGCGTCCGAAATTGAGGATAAACCACTTCCCCCAGTCTTTGTGAACGTG
GTAAAGAGAAAAAAAATTGTGGAGTTTAGTGCGCTGGAGATGCTAAAGTG
CAACGCGAAGATCAGTGATTCTTTGGCGGAAGTAGTGCTTATGAGCGACA
ACTCCGTTCAGAAATTGGTCGAGGACATTAGAAAGGAGGTACCGGCACTT
TACAGGGTGGCGGAGGGAATTGCTGTTCTCGACATGATTCTGTCCTTTGC
CCAACTCTGCACTATTCAAGACTACGGTAATGTTGCCTAATGCTGACCGG
CAGTTCAGCTCTCCCTGGAAAGCAACGCGTGGGGGACATCTAATGGTGTT
ATAGTTCGCCCAGAGTTCGCTGATACACTAGCTCTGAAAGCTGGACGTCA
CCCCATTCATGAAAAGATACACAAGGATCAATTTTTCCCCAATGACGTGT
ATGCAAGTCAACAATCTAGGTTTCAGATAATCACTGGTTAGTTCTGTTGG
GCCACCCGTATTACACAGAGCAATTAACGGCTCGGGGATCTAATGTATCT
AATGTCTGATTTGCTAGGATGCAATATGGCGGGGAAGTCGACCTATCTTC
GGTCAATTGCTCTCACCGCGGTTATTGCGCAAATAGGGTCATTTGTCCCG
GCACAGTATGCCTCATTCCCTATAACTCGGCGTCTCTTCGCTCGTGTCTC
GATGGACG

Sequences in the Contig:

SY0AAB34YN03FM1 SY0AAC17YJ20FM1 SY0AAC56YO22FM1
SY0AAD4YI12FM1 SY0AAD51YP13FM1 SY0AAD52YI11FM1