Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3815
Length(NT) : 1110
Best Gene Model Blast : Link to GSTUMT00007465001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein CIMG_04347
Accession: ref|XP_001244906.1| Score: 316 E_value: 3e-27
KEGG Definition: hypothetical protein
Accession: ang:An02g06140 Score: 310 E_value: 8e-27
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG3937 Score: 379 E_value: 4e-37
PFAM Definition: AAR2, AAR2 protein. This family consists of several eukaryotic AAR2-like proteins. The yeast protein AAR2 is involved in splicing pre-mRNA of the a1 cistron and other genes that are important for cell growth..
Pfam Number: pfam05282 Score: 335 E_value: 4e-32
Swissprot: Q4R7D0|CT004_MACFA

Sequence:
>Contig3815
TTGGCATCATTGAACGTAATCACATGAATCAATCGATCGATCAACAGATC
TATCGACAAACCCTTGCCCTTACAAAACTAGAACTACTTACTGCACACCA
CCACCGCTGCAATTACCGATCTCATCCCACCAATTCCATCAAACCAAACA
AGATGTCCCTGTCCCTGCACCTAACAACCGCCACCCTCCACCTAACCTCC
ATCCCACCAGGCACCTTCATAGGCATCGATCTGACAAGCTTCTCTTCGAC
GCCGGCATTCCAGGGCGTAAAGCTGATCCCATCGGGCCTGCACCTACTCT
ACTACTCCTCGACTACCGATTCCTCGCTACGCAACGGGTTCTGGTTCTAC
GCCTATCCGGGGCGAGTGATAAGCAAGGCGTGGGATCCCGCAGCTGAGAC
AGCGACGCTCGTCGATTCTCCTCCGTCGTCCGTGGGATTGGGGGAAAAGG
TGTACGCGGAGAACCTGATGCCGTATATGCAACGGGAAGAGTGGAGGGCG
TTGGGTGGGTGTGTGCAAGAACGCACGTTGGAAAGGTGCCTTGGGGGGGG
GTGGGTATGCGGGACTGCGGGGGTTTCGGGGATGGATTACGATGTTAGTG
AGGATGAGATCATGGGACTTCCGCCCGGTGGGGGAGGGGTGGATGTGGTG
TGGACAAATGTGGACTTGAAGGTTACCTGGCCCGCCGGCACAATCGGCCG
GGAGCGGACGGAAATGGCGAATGATAGAAGTTGGGCGCTCAATAATCTGC
TTCACAAACTAACCTCTAAAGACCAAGAAGATGCGGAAAGGGGGCTCCTG
AGCGAACTCCAGTTGTCATTCGTAATGTCAATCACCCTTGGTTCCTACTC
CGCCATGGAACAATACCGCCGCTTACTCGGCCTCTGCTTAACCTCCCGAA
CCTGCGTATTCCACGAACGGAGGAAGCTCTTTGAAGGGCTGCTCGAAACA
CTACTTGCACAGTTGGACTTCGTCGACGGGGACTTCTGGGCTGGCTTCAT
CGACGGTGGAGATGGGGACGATAATTGGCTCGCGAAGCTGCTCCGACGAT
TCGGGAGCGGGATTAAAGATGCGGGCAGCGAACAACAACGACTCGACCAA
GACAGGGATT

Sequences in the Contig:

SY0AAC17YJ16FM1 SY0AAC28YI19FM1 SY0AAC33YK16FM1
SY0AAC38YF19FM1 SY0AAD30YP23FM1 SY0AAD59YD11FM1
SY0AAD60YM01FM1