Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3814
Length(NT) : 952
Best Gene Model Blast : Link to GSTUMT00009162001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001215667.1| Score: 648 E_value: 8e-66
KEGG Definition: hypothetical protein
Accession: ncr:NCU04196.1 Score: 630 E_value: 5e-64
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2915 Score: 491 E_value: 3e-50
PFAM Definition: GCD14, tRNA methyltransferase complex GCD14 subunit. GCD14 is a subunit of the tRNA methyltransferase complex and is required for 1-methyladenosine modification and maturation of initiator methionyl-tRNA..
Pfam Number: pfam08704 Score: 488 E_value: 7e-50
Swissprot: Q2U3W4|TRM61_ASPOR
Gene Ontology:
GO:0016429 = Molecular function: tRNA (adenine-N1-)-methyltransferase activity

Sequence:
>Contig3814
TTGGGGGGACAACTTTGTACAAAAAAGTTGGATCACCTTCACATCAACTC
CCGGATCCGGCACTTTCGATCCTTATAACAAGGCAAAGATGCCCGAAACA
CCAGACCCCGACACGACCCCGGCCTCAAACCCACTCCCCCCTCCATCTGC
ATTTCTCCACACCCCCGAATCAATACCGTACTCATCCTCGCCGTCGATAA
TCCACCTAAAACGGGACCTACTTGTCCCCCTCTCCTTCCAATCCAACGGC
GCTCAGGCGGAAACCCATGACGCCCGCGCCGCAGCCTACAGCTCCAAAGG
CGTGCTAAACACCCGCTTCGGCGACTTCCCGCACTCCTCTATCGTCGGAA
TACCCTACGGGAGTCAGGTCCGCGCCGCACCGCGAACGAACAATGAACAG
AACCGGAAGCGCAAGCGGATGGAGGACGCTGATGAGGGAGAAACTGCCGA
ACCTGTATCTACGGGGTTCATACATGTGCTTGCGCCGACGGCGGAATTGT
GGACTGCTAGTCTGCCGCATAGAACGCAGGTTGTGTACATGCCTGATAGT
TCATTTATCTTGCATAGGTTACAGGTCCGGCCTGGGTCGGTGCTAATTGA
GGCAGGAGCTGGAAGTGGGAGTTTTACACATGCCGGAGTTCGTGCGGCGT
ACAACGGGTATCCAGATGGGAGGAACGGGAGTGGGATTGGGAGGGAGGGG
AGGAGGGGAAAGGTTTTTAGCTTTGAGTTCCATAAAGAGCGGGTGCAGAA
GTTGACGGATGAGATTGAGAGGCATGGACTTGACGGGTTGGTGGAGATTG
TGCATCGGGATGTTTGTAAGGATGGGTTTTTGGTTAAGAGGATGGTAGGT
GAGGAAGAGGAGGATATTTCCCCTGAAGCCACCGCCGTCTTCCTTGACCT
TCCGGCCCCTTGGCTTGCATTACCACACCTCACTCGCCGGGCACGCCCAA
CG

Sequences in the Contig:

SY0AAC17YJ11FM1 SY0AAC31YF11FM1 SY0AAC6YJ16FM1