Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3813
Length(NT) : 1096
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3813
AATGGCTAGCCAGCCACACACGCCGCTGTCAGTTCGACCTAGCAAGAGCC
TTCAAACGCAGTGTCGAATTCAGCTGGACAGAACCCCGCCTCCTCAGAAG
ACAAAGTGCATCACATGTTCCTACAAAGGACCCCTCCCCAAACAGCAGGA
AAGCTGCAAGATCTAGATCTACATCTGGTATTAACGGATATTATGAATAC
GGTTCAGGATGCCTCTTCCTGAAATATCGGATATTCGGCACAGCAAGATT
TACTATTCTACCTCTCCGCCGATATAGTACCCATCGCGGGAATCTTGCTA
CCGCCGTTCATGTTAAGTAGGATGGGGGACTTCCTAGATGGGTTGAGCGT
GCAGGCGGATATGCGCGGCTTCAGGTACACAGTTGTGGGCGGGGAGAGTT
GACAATTGGGGCTGGCTGCAAAGAAGGACGGCAAGGTGGTGGAGGGCGGG
GGTGGGGGGAAGAGAAGTATCTTGTTTCTGCACCAAATGAACGGCTCGAT
CAGTACTCGTAGAGTTGCTGTACTAGTAATTACCACCTCATCACCGCACC
TCACAAAGACATCCCTCCAGGAGGGGAAGGAGAAAAAAGCATTATATTAC
CAACCACTCCACCCACAAAGCTCTTCTCTTTATCCAAGGATTCACACAAT
CTAAAATAGAAATAGGGCACCAACGCTATCAGACTACCTTGTCCGTATCC
AGGGACATTCGAGTAATCAGATAAAAACGCCCAACCTCCCAACTAACTGG
TAACTCTCCTAATTCTTCCCAGTGTGAGCACCTCCTCTTGCTCCCCTGGC
TCCGTTTCCATCATCACCACCGCCCCTTCCTCTCGGTCCACGCCTTGGAG
TATTGACATTAGCCAGTGCGAGAACAGTACTATTGTCGTCAGTAGAGGAC
TGAGGCCTCTCAAAGATCACTGAGGGAAGACCATGTAATAATTCATGCTC
CCTGCAGGAACAGATACCGTAACCGTCATCTTTGTATCATAATAACAAAA
TTAAATGGATCACTACGCTGGACAAAGTCGCCATTGCGCTCGCCAACAAA
TACCTTCTATCCGCTCCTTTATCTTGCTTTCCCGACCCATCCTCCC

Sequences in the Contig:

SY0AAC17YJ10FM1 SY0AAC18YJ10FM1 SY0AAC42YM20FM1
SY0AAC47YJ09FM1 SY0AAD6YJ15FM1