Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3812
Length(NT) : 985
Best Gene Model Blast : Link to GSTUMT00010440001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: inorganic diphosphatase
Accession: ref|XP_754776.1| Score: 1216 E_value: 1e-131
KEGG Definition: inorganic diphosphatase, putative [EC:3.6.1.1]; K01507 inorganic pyrophosphatase
Accession: afm:AFUA_3G08380 Score: 1216 E_value: 1e-132
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG1626 Score: 976 E_value: 1e-106
PFAM Definition: Pyrophosphatase, Inorganic pyrophosphatase..
Pfam Number: pfam00719 Score: 612 E_value: 3e-64
Swissprot: Q6MVH7|IPYR_NEUCR

Sequence:
>Contig3812
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGTCCACATCTGCCCCTGT
TGCGCCAAGGCAAAAATACCCCTCAGCCTGTCCACCCGCACTGTCCCGTC
TTGGGTTTGTGCTTGAGGATATATAATATCCCTATGCTACTACCCCGCAT
ACTCTCCACTTCTCTCTTCCTTCATTCCCTAATACACACGTCCCATTCGA
CTTGCGCTCAACCACTCAAACTGTCGTCAAGAAGTGCATTAATCGCTCGA
CATCTCTCCGCACCCTCTGAGATGTCTTACACCGTGAGGAAAATCGGACA
GCCCAACACTTTGGAGCACAGGGTGTATATCGAGCAAGACGGTGTTCCAA
TTTCGCCATTCCATGATATCCCTCTCTATGCAAATGAGCAGAAGACCATA
CTCAACATGATTGTCGAGATCCCTCGCTGGACCAACGGAAAGCTTGAGAT
TTCCAAGGAGGAGCTTCTCAACCCGATCAAGCAAGATGTCAAGAAGGGAA
AGATAAGATTTGTTCGCAACTGCTTCCCACACAAGGGATACCTTTGGAAT
TACGGTGCTTTCCCTCAGACTTGGGAGGACCCCAATGTCATCCATCCCGA
GACCAAGGCCAAAGGTGACAACGACCCGCTGGATGTCTGTGAGATTGGCG
AGACTGTAGGTTACACTGGCCAGATTAAGCAGGTCAAGGTATTGGGTGTT
ATGGCTCTTTTGGACGAAGAGGAGACCGATTGGAAGGTTATTGTCATTGA
TGTCAATGATCCTTTGGTCCCTAAACTCAATGATATTGAGGATGTCGAGC
GCCATCTTCCTGGTCTCTTGAGGGCCACCAACGAGTGGTTCCGTATCTAC
AAGATCCCGGATGGAAAACCCGAGAACCAATTTGCATTCTCTGGTGAGTG
CAAGAACAAGAAATATGCTACCGACGTCATCCGCGAATGCAGTGAGGCAT
GGGAAAAACTCATTACTGGCCAAAGTGACTCAAAC

Sequences in the Contig:

SY0AAA26YE14FM1 SY0AAA41YA15FM1 SY0AAA44YO09FM1
SY0AAB18YP17FM1 SY0AAB19YG04FM1 SY0AAB38YO15FM1
SY0AAB46YH17FM1 SY0AAB46YM09FM1 SY0AAC17YJ07FM1
SY0AAD20YD13FM1 SY0AAD51YO04FM1 SY0AAD56YA03FM1
SY0AAD8YG04FM1