Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3811
Length(NT) : 684
Best Gene Model Blast : Link to GSTUMT00005653001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: spindle assembly checkpoint protein SLDB
Accession: gb|AAC39458.1| Score: 382 E_value: 3e-35
KEGG Definition: mitotic spindle checkpoint protein BUB3, WD repeat superfamily; K02180 cell cycle arrest protein BUB3
Accession: aor:AO090023000208 Score: 375 E_value: 1e-34
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG1036 Score: 418 E_value: 6e-42
PFAM Definition: No Hit Found
Swissprot: O43684|BUB3_HUMAN
Gene Ontology:
GO:0000776 = Cellular component: kinetochore
GO:0005515 = Molecular function: protein binding
GO:0008283 = Biological process: cell proliferation
GO:0007093 = Biological process: mitotic cell cycle checkpoint

Sequence:
>Contig3811
TTGGGCGCCCGCAAGTTGTGAAATAACTTTCTCCCCTTCCACAGCTACAA
TAATTCACATCCACATCCAAAATGTCACAGCGTATGCATCCCAAGCCTCC
GCTACAAGGCCTATGGACCAGCCATTCTAATCGTGGGATCTAGCTGCAAA
CCAATTTGAGCTCTCTGGCCCCCCAGAAGATGTAATCTCTTCCCTCACCT
TTTCCCCGAATAACCCCTCACGTCTCCTTGTCTCCTCCTGGGATAGGAAT
GTCCATCTTTACGACACAAATGCTGGCCTGAATGGCTCGAAACTGACTGC
ATTCCCTCATGCAGCGTCGGTACTAGACTGTTGTTTTGGCGAGACGGACA
GCAATGTGTTTTCTGCTGGACTAGATTGGCAGGTTCAACAACTCGATCCT
GAGACCGGTAGAGGGAACACCCTAGCTACACACGAAAACGCAGTAAAATC
CATTTGCTACAATGCGGAAACTAAATCTCTCTTGAGCGGCTCTTGGGATC
AGTCAATTAAACAGATCGATCCTAGGTCCCTAGAGTCTACCAGCTCCCAC
GCCCAACCACATAAAATATTCTCATTGTCGACAATTTCACATATACTAGT
TGTTGCCATGTCGTCCCGCTCGGTCTACCTCTACGATCTACGCAATATGT
CCTCCCCGTGGCAGCGCCGTGAGAGCTCTCTCAA

Sequences in the Contig:

SY0AAA30YD07FM1 SY0AAC17YJ02FM1