Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3810
Length(NT) : 919
Best Gene Model Blast : Link to GSTUMT00005273001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_07385
Accession: ref|XP_001554248.1| Score: 185 E_value: 4e-12
KEGG Definition: hypothetical protein
Accession: fgr:FG07271.1 Score: 129 E_value: 6e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3810
TGCGGCTCAAGTGGTCAAGTTGATTCGGAATAGGAGTTTATATCTTCATT
CGGTTGTGCATCACCCACCGATGACTAGGATAGATGCTTTGACAGCGAGG
TTGGAAGAACTGAGTGCTGAAGTTCGAGATCTCACATTGATGACGACCAA
GGCTGTAGATAGAGGTTCTCATTTGGATGCTTTGACGAGTTGAGCCTCCT
GCTGATCGCACATGTCTGCCCTAGGGGAATGGATTGCTAATTCGGGCTCG
TAGGAGCGGTGCGCCGTTACGAAAAACGAGAGACGGTTCACTCTGCCCAA
ACGGAGAATCGAATCCTTGAGATAGACAACCGTCTAAACGATGTTCTTAC
CCTTACTGCTGCTGCTTCTGCTAGGCAAAACCACACCACCTTCTCGATGA
TCCTGTTCGAGTGGGCCTGTGCTGCGATCGTCATCCCGTTCTCGCTGACC
TGGAAACTTATCAGCCTGCCGGCCAAAGCTGTGGAAACTTTAGCGGGTTT
CGGTAAAAACCAGAAATTGCTGAAGAGTGGGCGTCGTCAGCAGCCAAGAT
TGAAGGGTAGATCGAAAATGGGTAAATCTAAAGATGCGGGGGGTTGAGAC
AGATGTTTGCCGGCTTGGTAGGGAAGGCTTAATCATGGATTTTATGGCCT
ATATGGGTAATGAAGGAAACATCTGTCGCACGTGCTAATGAAGGAGATGT
TATCAAGATCGTTAGCGGGGGACCGTTATTTATCCTGGGGCGTTTGTTTG
CTTTTTCCCACTGTTCCTCCTATTTCATTCTTTTCGTTTCCATCACCACC
TCCACTCACTAGGGTCACGAGAAAAATTGAGATGCGTAGCACAGCGCACT
AGCATAGGGGCTGTTTAACGTCATAATATGAGATGATAATATTATTATCA
TGATGGGAGATTTATACTT

Sequences in the Contig:

SY0AAC17YI10FM1 SY0AAC3YI04FM1 SY0AAD59YF14FM1