Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig381
Length(NT) : 830
Best Gene Model Blast : Link to GSTUMT00007410001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: hypothetical protein SS1G_12988
Accession: ref|XP_001585896.1| Score: 666 E_value: 5e-68
KEGG Definition: hypothetical protein
Accession: fgr:FG07263.1 Score: 542 E_value: 6e-54
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG2495 Score: 519 E_value: 1e-53
PFAM Definition: Pyr_redox_2, Pyridine nucleotide-disulphide oxidoreductase. This family includes both class I and class II oxidoreductases and also NADH oxidases and peroxidases. This domain is actually a small NADH binding domain within a larger FAD binding domain..
Pfam Number: pfam07992 Score: 187 E_value: 4e-15
Swissprot: P40215|NDH1_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0003954 = Molecular function: NADH dehydrogenase activity
GO:0005515 = Molecular function: protein binding
GO:0001300 = Biological process: chronological cell aging
GO:0019655 = Biological process: glucose catabolic process to ethanol
GO:0006116 = Biological process: NADH oxidation

Sequence:
>Contig381
TTGGCTTCGTCTCAATTTTGAGAAAAGTTACCCTACCATATTAACTCGTG
TGATACCGACTTCTGTGGTATGATATGGCGACGATATTGCGAAGAGAGAC
TTGTGTTCGGGGGGTGAGTCGACGGGCAGCAGTTTGCGGAGGGAGCATAA
TCCAGCGAAGGACTTTCTCGTTACAGGAATTGGACGAGAAGAGGGGGACC
CGAGAGCGCGTTGTAATACTCGGGTCAGGATGGGGTGGCTTCGGGCTCGC
CCGGCAGCTCGACCTACGGCACTACCAACCCCTAATTATCACTCCAAGAA
CGTACTTCGTCTTCACTCCGCTGCTCGCTTCTACCGCCGTCGGAACGCTG
GAATTCCGACAGGCGATGGAGCATTCGCGTTCCCGGCCTGGCATCGAAGT
TATCCGCGCTTGGGCAGAGCAAATTGATCTTTCGAAGAAGACGGTCACGG
TTGAAGGTGCTGTGCAGAGCAAGGATAAGGTGGGGAGTGTCATTGGTGAT
GGAAAGCAGTTTGAGGTGGGATGGGATAAAGCTGTTGTTGCCGTGGGAGC
TTTCAGTCAGACTTTCGGGGTCGAAGGGGTTAAGGACCATGCTTTTTTCC
TGAAAGATGTGGCAGATGCTCGGGCTATTCGGAGGAGGATACTGGAGTGT
TTCGAAGAAGCAGCTTTGCCCACCGCAAGTGAGGCACGGAAGAAACAACT
TTTGCATTTCGCTGTTGTGGGGGGGGGGCCTACTGGGATCGAATTTTCCG
CTGAATTACATGATCTCTTGTCGGACGATCTCACAAAGCTGTATCCATCC
CTCGCCAAGTACCACCGTATCACAGTATAC

Sequences in the Contig:

SY0AAA22YH05FM1 SY0AAA37YB16FM1 SY0AAA42YB20FM1
SY0AAA6YM18FM1 SY0AAB20YB14FM1 SY0AAB40YO09FM1
SY0AAB9YG11FM1 SY0AAC49YA03FM1 SY0AAC56YB12FM1
SY0AAD23YP02FM1