Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3809
Length(NT) : 453
Best Gene Model Blast : Link to GSTUMT00005985001 E-value : 4e-84
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3809
AGGATTTAGTGATATTGCCTTATATAATAATATCATAATATTATGATAGG
AAAGAAGAAATCATTAGTCATTCTCATGCTTCTTGCTCTGTTGCGTGGGC
CCATGGTAAGCACTTGAAAATCACATGTCGTCTAGCACTCCCGACCAGCC
CATAGAAATAAGCCCAATAAATCGATCCCTCCCCCTTGTCAGAGGCAAAC
GTGACCGGGGGCCCTTGTTCCATAGTAACAAATAAATAACACTAAACCCC
TCCCACGTCTAGACTTCTAACCACCCGTTTCCTAAACGAGTGGGTCTCTA
GTGTTCCATAGGGGTTCCCTGGTTCTCCAGATCGGGTTCCCTTTCCTCCT
CCTTGGGCTGGAGAGCCTCTTTAACCATGAGGAGCATCATAATCTTTGCT
GGTTTCATCAACCAGTCAACCAGCCCTGTATCTTTTTGCGTGCTATCTTT
TTG

Sequences in the Contig:

SY0AAC17YH18RM1 SY0AAC20YH24RM1