Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3808
Length(NT) : 1197
Best Gene Model Blast : Link to GSTUMT00010892001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein CIMG_08516
Accession: ref|XP_001241353.1| Score: 983 E_value: 1e-104
KEGG Definition: hypothetical protein
Accession: ani:AN6978.2 Score: 964 E_value: 1e-102
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG0783 Score: 222 E_value: 6e-19
PFAM Definition: No Hit Found
Swissprot: P28745|RCC1_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0005087 = Molecular function: Ran guanyl-nucleotide exchange factor activity
GO:0030261 = Biological process: chromosome condensation
GO:0007093 = Biological process: mitotic cell cycle checkpoint
GO:0007091 = Biological process: mitotic metaphase/anaphase transition
GO:0006406 = Biological process: mRNA export from nucleus
GO:0007346 = Biological process: regulation of mitotic cell cycle
GO:0007264 = Biological process: small GTPase mediated signal transduction
GO:0051225 = Biological process: spindle assembly

Sequence:
>Contig3808
TTGGGAGAGAGAAATCTGTCGAACCGGCCCGCAAGAAGGGTCGCGCTAAA
GCTAAAGCGCTCGCGGACCCTAAAATAACATCTGTCCCTACCCGGCGACT
GAATATTTACGCGTTTGGTACTGGCGATAATGCCGAGTTGGGCCTTGGGC
CAGAGGTTAACGCAAAGGTTGTCAAGCGCCCTAGATTGAATACCCATCTT
CTCCCCGAAAAGGTTGGAATTGTTGCTGTTGCGATTGGTGGTATGCACGG
TTTGGCTTTGTCGCATGAGGGGAAAGTCTACTCGTGGGGTGTCAATGATC
AGTACGCCCTTGGGAGGGAAACGAAGTATACTCCTCCGGTGGGAGATGTG
GGTTCCGATGAGGATAGCGACAGCGACGACGAAGAACCCTTGAACCCATT
GGAGAGCATGCCAATGCTAATTACAGCGTTCCCAGAGGGGACTGTAATTA
CAAACATTGCTGCCGGTGATAGCGTTTCAATCGCTGTTACAGATACCGGC
AAGGTTTATGGGTGGGGAACATTTAGGTGCTCCGACGGCATTCTTGGATT
CAATGAGAAGACCCGTATACAGAGCGTTCCCGTTTTACTACCTACACTCA
AGAACATTGTTCAAGTTAGCGTCGGCACTGATCACGTCCTCGGCCTTACG
AGGGAAGGAAACGTATTCGCGTGGGGCAATGGCCAACAATTCCAACTCGG
GAGGCGTGTTGTTGAAAGAACCCGCCTCAATGGGCTCATTCCTCGAGAGT
TTGGTCTTCCTCGCCACCAGGTCAGGTACGTCGCTACCGGCTCATATCAT
TCTTTCGCAATTACCGAAGACGGGAAGGTCTGGGCGTGGGGACTCAACCA
ATTTGGCCAATGCGGGATATACGACCCGAAGCACGCCGGGGAAGACAACA
CCGTGGTTCCCGTTCCCACCGTTGTCCAGGGCCTTATAGAGCATAAGATT
GTTCAGATATCCGCTGGAGAACATCACTCAGCCGCCGTGACCGAGGACGG
TGAGCTTCTGGTCTGGGGCCGTCTCGACGGTGGACAACTTGGTTTGGACC
CTGAGACACTCCCAGCGGAAGACGTTGTCCGTGACGTATCTGGCAAGCCT
CGCTATCTTTCGACCCCGCGTGCAGTCCCTGACATCAAGTTCTCCTTCAT
TGGCTGCGGCACGCACCATAATATAGCTATCTCGAGAGAGGGGCAGG

Sequences in the Contig:

SY0AAA23YA05FM1 SY0AAC17YH03FM1 SY0AAC36YH17FM1
SY0AAD30YK02FM1