Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3807
Length(NT) : 719
Best Gene Model Blast : Link to GSTUMT00008941001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_503693.1| Score: 322 E_value: 3e-28
KEGG Definition: hypothetical protein
Accession: yli:YALI0E08360g Score: 322 E_value: 2e-28
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P10356|YEY2_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig3807
TTGGGCGAACCCGGTATGGTTCCAACGCCGCAGTAACCCCGCCCCCTCCT
CCCTTTCTCTGACAATTCTGGGTTTCGCCCCTGCTCACAAAGACTCGAGA
GAAGGGGGATCTGATCTCTCCTCTCTGGCGTCATTAGCCCGACTCAAAAT
CTCATCATCCGTATCTGTACGGTACACAGTCCAACATGCTTGCTAACCTC
CATAAACCAATCGATCTCCTCCGAGGCCACCCATCGACCCGCCTTCTTGC
AGTGGACCTGATTCGCGAGTCCGCTGCTAAGGTCCTTAGCTCTGACCTTC
CACAGGATAGTTATGCCCAGGTTCGCCACCCATTACATTACGGACCTAAC
ATGGGGAACGAGGACTTGCGTGCTGAGATTGGAAGATGGACTGCTGAGCG
ATATGAGCTCAAAGAAGCCATTCCTGCGGAGAGAATTAATATCACTCCCG
GGGCATCGTATGGGCTTATGAGCACGCTTTTACTGTGTACTAGTCCCGGA
ACTGGGTACACGAAGCAGGCGTTCGTCGTTAGCCCGACCTACTTTTTAGC
AGCAAGTGTGTTCCAAGACGCTGGGTTTTCCGGGAAATTGACCGCTATAA
GGCTTAACAAGAATACGATTGACACCGATTCCTTGGTGGCTCACCTCGAG
CGTATCTCTGCCTCTGCTCCAGATGTCCAGCTTCCAAGCGGCCTGGAGCC
AATCTCTAGGGCCGGCGCT

Sequences in the Contig:

SY0AAA19YL13FM1 SY0AAC17YG03FM1 SY0AAC32YD06FM1
SY0AAC53YO03FM1