Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3806
Length(NT) : 978
Best Gene Model Blast : Link to GSTUMT00002690001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein CIMG_09673
Accession: ref|XP_001240052.1| Score: 531 E_value: 3e-52
KEGG Definition: XAP5 domain protein
Accession: afm:AFUA_6G10680 Score: 504 E_value: 2e-49
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2894 Score: 398 E_value: 2e-39
PFAM Definition: XAP5, XAP5 protein. This protein is found in a wide range of eukaryotes. Its function is uncertain. It is a nuclear protein and is suggested to be DNA binding..
Pfam Number: pfam04921 Score: 371 E_value: 3e-36
Swissprot: Q14320|FA50A_HUMAN
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0007283 = Biological process: spermatogenesis

Sequence:
>Contig3806
TTGGCAACCACAAACGACACCACCAACGCATCTATACCAGCATCCACCAT
GTCCGGTCCAGCCGCCAGCACACCCTCGCGCTTTGTCGCAAACACCGAAA
CTCTGGAGGACGTGCTAAAGACGCAAACCGTCGGTCTCGTGCATTTAAGC
GAATTCAAGAAGCGCCGTGTGGAATTAGCCGAACAGCGAGATCGCGAAGC
AGCTGAGAAATTACAACCCATTCGCAGCAGCGGAGGCGGGGGAGGCTCGA
GCTCGTCTCGTGAAGGCAGTGAAGCGCCCACCGGTAGCAGTGGCGGCAAG
AGGACAAATAAGCGCAGGAAGGTGGTCAAGGGGAAATTGTCGTTTGCGGG
GGAGGACGATGGCGATGATGGTACGGATGACGGCGGCGACTCTTCATCCG
CCGACCCAACAAGGTCTAATAGCGAGGATAACAATAAGAGTGGTGAGGAG
GATGAGGTGAAGAAGCGGAAGGTCAATCCGAAATTGGGTCTGCCGGCTCC
GAAGGTCTTGACGAAGAATACGCTTTTGAGGGAAGCTCAGGAGCGTGAAA
CCTTGAGGAGGGAGTTTTTGGCTTTACAGGAGAAAATTAAAAATGAAGAG
ATTAGCATTCCGTTTGTCTTTTACGATGGCACCAATGTTGCGCCGCCCAC
CGGAGAGGGAGTGACAGTTAAGAAAGGCGAGGCTGTATGGCTATTCCTCG
AACGTGCTAGGAGAATGTCTGGACGCAGGGAGTGGCTCAGAGTATCGGTC
GATGATTTACTGCTGGTTCGGGGTGAAGTTATAATACCTCACCACTTTGA
ATTCTACTACTTTATCGTCAATCGCACGATGGGGCCCAACGGACTATTGT
TCGATTTCCCTTCATCTCCATCGCCCACACCCCAGACCCCCACCACTAAT
CCCAACAGAGATGACCCCACAATGACTAAAGTGGTGGATCGTCGCTGGTA
CGAACGGAATAAACACATATTCCCTGCA

Sequences in the Contig:

SY0AAA16YJ18FM1 SY0AAB40YG08FM1 SY0AAC17YG01FM1
SY0AAC27YK11FM1 SY0AAC36YO22FM1 SY0AAC41YO24FM1
SY0AAD50YI03FM1 SY0AAD52YL22FM1