Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3805
Length(NT) : 835
Best Gene Model Blast : Link to GSTUMT00009949001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_10502
Accession: ref|XP_001550943.1| Score: 307 E_value: 7e-42
KEGG Definition: rRNA maturation protein (Nop14), putative
Accession: afm:AFUA_8G04220 Score: 296 E_value: 9e-36
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2147 Score: 256 E_value: 5e-23
PFAM Definition: Nop14, Nop14-like family. Emg1 and Nop14 are novel proteins whose interaction is required for the maturation of the 18S rRNA and for 40S ribosome production..
Pfam Number: pfam04147 Score: 263 E_value: 7e-24
Swissprot: Q6C2F4|NOP14_YARLI
Gene Ontology:
GO:0005730 = Cellular component: nucleolus
GO:0005515 = Molecular function: protein binding
GO:0030515 = Molecular function: snoRNA binding
GO:0030490 = Biological process: maturation of SSU-rRNA
GO:0042274 = Biological process: ribosomal small subunit biogenesis and assembly

Sequence:
>Contig3805
TTGGGGACAAGAAGCCCTGGGTGGGGATGATGTAGATTTGGGGGATGCGG
CCGAATACGGGCTAGGAGCTGGTGTCCCTATGGCGCCCGTTGGGGGAAAC
TTCAATCCCGATGAATTGGTCGACGGCGATTATGAAGCTTCGGAAGATGG
GTATATTGATGTTGACGAAAACGGAGAAGCTAATGCCTCTGATACAGAGC
AGTTAGACGACTATAACTCTGATTATAGTGGTGTAGGTGGTTCTGATGAT
GAACCCGAGGAGGGTGAAGATGATGATTTCCTTGAAACCCTCGGGAGCCA
ATCGGGAAGAGTGGGGACGGGACCTGGCGTCTTCGATCTTTCAAAGGTGG
ATGGCAAGTACAACAAGCTTGCATTTACCTTCCCCTGCCCGCAAACGCAT
GGGGAGTTTCTAGAGATTGTCGGGGATATCCCAATAGATGATCTTCCAAC
TGTTGTTCAGAGAATCAGAGTCCTATACCATCCCAAACTTGATGCTGAGA
ACAAGCACAAGCTTGCTCGGTTCTCTGAAATTCTCCTTCAACACATACTC
CTAGTTGCTAATAAAGCTCCATCCGCACCGCCCTTCAAGCCCTTAGAAAC
TCTAATCCGCCATCTCCATGCTCTAGCAAAATCCTATCCAGATACTGGTG
TCACGAGCCTTCCGCGAACACCTAAATATCATACATGAACAGCGCTCTAC
GGGAGACTTGAAAGCCGGGGACTTGATCCTCTTCACCGCGATTAGCACAA
TATTTCCTACAAGTGACCACTTTCACCAAGTCGTCACTCCAGCAATGATT
GTAATCTGCCAATGGCTCGGGCAAGTATCCCCCAA

Sequences in the Contig:

SY0AAC17YF06FM1 SY0AAC48YP03FM1