Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3804
Length(NT) : 1059
Best Gene Model Blast : Link to GSTUMT00001474001 E-value : 5e-73
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3804
TTGGGGCGGAGGTTACCCATGAAGGCAGTTTTGATAACTAAGGACGCCGT
CGGCATGCGAGAGGTGGGAAGTGATGATAATATTTGGATGGCTGGGTCGT
GCTGATCATCAAATGTCACTCGAAGACAGGGCTGGATCTCTGCCGGTTGA
TTGGGGGCAAGAAAGGCTTGGCGAGGACCGATTTCACGTGAGGGATAGCC
GGCTGGTTGGGTAGGTAGGTAGGTAGGTCTGTAGCTGACCAGGGGTTTTC
GATCTTGTTATTTTCTAGGGGTTGACACTGTGGGGAATCAGAAAGTGATT
GAAGTGGGGATTCCGTGTTGGTCATCGTGGATAGGCGGGGTAAGGGATGG
GGGATGGGGTGTTGAGCATTCTAAAGGAAGAGCGTCATGAAGAAGGTATT
AAGGCGAGTTAATGTTCTGGTGAGTGATCTGCCGGGGGGATCCCAATGGT
TGGATTTGTGTGTGTGAGGGTTTGTGTCTGGTATCCGGCGGTGATATAAA
TTGGGTATACTGTCTACTTCTACAAGTTGGTTGCCCCCTCTTTCTCATCA
CCCGAAAGTACGTGCGCCACAGCTGTATTCCGAAAAACTGGGGCAAACAG
AGCACACGTAACCTTCATCACACAAATTTATCTTATATGATACTACCATC
CGTTAGCAAGCTAATGTGCTCTCGCTACGGAGATTCTTTCACGTTGGGAT
TTTCAAGCGTTAGAGTGACAATTCATGATGCAGGGTAAAGTCGACAGATC
TGGGGGGTATCCTCTCACTTGCGCGATCGAGATTGGCAGGATTGCCCGAT
GTTTGCATAGGGATATGGGAGAAGCCGGTTGAGACAAAATAGCTTGGGAC
AGGTATCATAGGTTGGGGTATCGGAGAGGGATCTCTGGGCGGAAAGTTGT
CCGGGAGATGCTGCGGGGTCACAGCGGGCTTTGGGCAAGAGTAGGTGAAG
GAGCAGGTGGTGGCTTTACCCCGCTTGTGGGCGTCAGGCACTCTGTTGGG
GAAGATAGAGAGTGTGGCGGGGAGGAAGTGGTCTCATGCTGCTAGCTGAA
GAAAAGAAG

Sequences in the Contig:

SY0AAC17YE06FM1 SY0AAC55YP01FM2 SY0AAD49YO01FM1