Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3803
Length(NT) : 886
Best Gene Model Blast : Link to GSTUMT00005258001 E-value : 1e-169
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_03624
Accession: ref|XP_001557361.1| Score: 457 E_value: 1e-43
KEGG Definition: predicted protein
Accession: aor:AO090009000649 Score: 391 E_value: 2e-36
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P53584|YTP1_YEAST

Sequence:
>Contig3803
TTGGGATATGCTATGGTAACCAAAACTGGTGCCCGTCCGTTCCAATGCAT
ACTGACGTGAAAATTCTTCAAGTCTGCACATCCTCAGCATTTGCCGCTCT
CAACCATGGTGCACAGTGTATTTGGTTACACCCTTATGGCAGCCGGGCTA
GCGAGGGTCATCGAGATTGCGTTTGTTCTGCGAGATAAACCTGCCCTTGA
TGGAGAACCGAACAGCTTCCAGCATTTGACACCATTTCTGCTCTTTGCTT
CGGGTCTTAGTAAGTTTCGTGGTCCCAAGATTGGCAATTGGTCACATGCT
GGCCTTTGAATGTGTTGACTGATGGCTCACGTTTTGACAGTTTTCATGTG
TGCCACCGAAGAGCAACTTGCACTTGTCAGCTCCGCTGAGATCGATCACG
TGTCTTATCTTCTCGTCCTATACAGTGTGGCATTCCTGATGTACCTCTTT
ACAATGGTCCTCATTCACATATATGTCTCGAATCCTAGGGACGCGAAGCA
AGCCCCTCCAGCCGTCCTGGCAGAGCGTGGCATGAATGGTCACGTGGATA
GGAGGGTCCACGATGCTGAAGAGTTCGAACTCGAGGGCCTGATCAGCGAA
GACGAGGGGGAAGAGAATAAGCAAGAGAGTAATCCGTAGTATCACTATAG
GGGGGGCTAAACAGCGATGACAAAAATGTTTAATAATGGGACTTGGGCCT
GCCGAGCCCACGTGGCGGAACCTGTTTTCGGAGGAGGGACAGGAAGGGTA
TTAATAGCATCCGGGCGTTATGGGCGTTCTCTTTTTCGTCTATTATCATG
GAGTGATCATGTACATTTCATTCTGCATCGTAGTTTGGGGGATAAATCAT
GGGAAATACTGCTAGTACTTATTATAAGTACTCGGG

Sequences in the Contig:

SY0AAB48YL04FM1 SY0AAB55YF17FM1 SY0AAC17YD04FM1