Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3802
Length(NT) : 1965
Best Gene Model Blast : Link to GSTUMT00007603001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein BC1G_05548
Accession: ref|XP_001555873.1| Score: 459 E_value: 2e-68
KEGG Definition: hypothetical protein
Accession: ani:AN1130.2 Score: 367 E_value: 1e-56
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 356 E_value: 4e-34
PFAM Definition: No Hit Found
Swissprot: P16157|ANK1_HUMAN
Gene Ontology:
GO:0016323 = Cellular component: basolateral plasma membrane
GO:0005856 = Cellular component: cytoskeleton
GO:0008093 = Molecular function: cytoskeletal adaptor activity
GO:0019899 = Molecular function: enzyme binding
GO:0030507 = Molecular function: spectrin binding
GO:0005200 = Molecular function: structural constituent of cytoskeleton
GO:0007010 = Biological process: cytoskeleton organization and biogenesis
GO:0006887 = Biological process: exocytosis
GO:0045199 = Biological process: maintenance of epithelial cell polarity

Sequence:
>Contig3802
TTGGGCTGGAGATGGACACCGAGCCCGACGCGATGTCTGACAGTTTACGG
GCGGATATCCTCAGGATTATTCCAGAAAGGGTATCTGAAATATTCCTACT
TGTATCACTGAGCATTGATGTTATCCTGGCGGAGGTTACGGTTGGTGAGA
GGGAGCAGAAGTTGAACGAGCTTAGAAGGGCAATCATGTGGAAGATGCAT
ACGCGACAACTTTGGCACGAATAAAGGCACAGAAGGGGAGTAGACCTAGA
CTCGGAATGGAAGCCCTGATGTGGGTATCGAATTCGGAGCGACCATTACG
CACTCGCGAGTTATGCCATGCTTTAGGAGTCACAATAGGATGCGCAGAAT
TGAATGTAAAGAACGTTCCTGCAATTCAAACACTCCTTGAGTGTTCTTTA
GGGCTCATCACGGTCGATTCATCCTCCGACACGGTCCGGCTCGTCCATTT
AACGCTACGGGAATATTTATCGAGCAACCAAAGTCTGTTCCAAAGTCCAC
AGTCAATGATAGCGGAGGTTTGCTTGACGTACCTCAATTTCGGGTGTGTT
CGGGAACTTTCGTCGACTCTTAATTCGGCCCCGCCGTTAGTCCCCCTTGT
CGAATATGCTTCGTGCTATTGGGGAACACACACAAGGATGCAGGAGACAG
AGGATGTCAGCCCACTTGCACTTGAGCTTCTTCTTGGGTTTGAAGGGCAT
ATATCCTCTCGGTTACTCTTGCTACGTTATAATAAGGATAGATGTTGGTG
GGAGCCAGGCTTCCATGCGATGAGTGGCCCTAATGGCTTTACAGGGCTCC
ATGGAGCAGCATTTCTCGGGCTTGTAAAAACAGTCGCTGCTTTATTGGTG
AAGGGGGAATGGGACATTAATGTAACAGATGCTGTAGGTAGAACGGCTCT
CACATGGGCAGCCATAGGAGGCCATGTTGATGTTATAAAGACGTTGTTAG
AGCGGAAGGATGTCAATCCCAACAAGTGCGGACACCGCTTATAGTCGAAC
ACCACTCTGGTGGGCAGTGATCCGCGGGGACAACGAAGTGGCAAAGTTGT
TATTAGAACGAGTGGACACCGATCCTAACAGTGCCGACACTTATTATGGT
CGAACGCCACTCTGGTGGGCTGCGAGGGATGGGCATGCGGCACTAGTAAA
GTTGTTGTTGGAACGAGCGGACACCAATCCCAACACTGCGGACACTAAAT
ATGGCCAAACACCACTCTGGTGGGCTGCGGGGTGTGGGCATGGGGCGGTC
CTGGAGTTGCTATTGGAGCGAGGGGACACCTATCTGAACACTGCCGACAA
TGAATATGGTCAAACACCACTCTGGTGGGCTGCGAGGTATGGACATGAGC
GAGTCGTAAAGCTGCTATTGGAACGAGAGGACACCAATCCCAACACTGCC
GACACCCAATATGGTTGGTCACCACTCTGGTTGGCTGCTGAGGCTGGGCA
TGAGGGAGTTGCAAGGCTGTTGTTGGAACGAGAGGAAATCGATCCCAACA
CTGCCGACACTGAATATGGTCAAACACCACTATGGTTAGCTGCAAGGCAT
GGCCATGAGGGATTCATAAAGTTGTTATTGGAACGAGAGGACGTCAATCC
CAACACTGCTGATACTAAGTGCGGTCAAACACCACTCTGGTTGGCGGCGA
GGTGGGGACATGAGGGATTTGTAGAGTTATTATTGCAGCGTCAGAACATC
AATCCCAACACTGCCGACTCAAAATATCGCCGGACATCACTCTGGTTGGC
TGCAAGGTGGGGGCATGTGGGTGTAGTGAACTTGTTATTGAAACGGCAGG
ATATCAATCCCAACACTGCCGACACTGAATACGGCCAAACGCCACTCTGG
TTGGCTGCGTGGGGTGGGCATGGCAGAGTAGCAAAGTTATTATTGCAACT
GGAAAACATCAATCCTGACACTGCCGACACAAAATATGGTCGCACACCAC
TATGGTTAGCTGCGA

Sequences in the Contig:

SY0AAC17YC23FM1 SY0AAC27YL20FM1 SY0AAC28YB20FM1
SY0AAC43YB24FM1 SY0AAC59YM18FM1 SY0AAC60YG15FM1
SY0AAD60YG15FM1