Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3801
Length(NT) : 1409
Best Gene Model Blast : Link to GSTUMT00003752001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein BC1G_14726
Accession: ref|XP_001546912.1| Score: 978 E_value: 1e-104
KEGG Definition: hypothetical protein
Accession: fgr:FG09513.1 Score: 947 E_value: 1e-100
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG2137 Score: 539 E_value: 1e-55
PFAM Definition: No Hit Found
Swissprot: Q8CFE4|SCYL2_MOUSE
Gene Ontology:
GO:0010008 = Cellular component: endosome membrane

Sequence:
>Contig3801
TTGGACAACTATCTATCTTCTCGTCCACTCCCACGACCACTTGTTGAGAC
GCTCCTCTCCAGACTGCTAACGAGACGGCCGGCAGGTAGGGTTACAGCGT
GCGGATTTCAGCAGAGTCCCTATTTCGATAATATACTTGTTTCAACCCTG
CGATTTCTGGAAAGCCTTCCTGCCAAAACTCCGTCAGAGAAATCGTCCTT
CATGCGCGGGTTGCTAAAAGTGCTTCCGCAATTTCCTAGGGGTGTTCTTG
AGAAGAAAATCCTTCCAGGACTTGTTGAGGAACTCCGCGACGGCTCAATG
CTAGCTCTAGTTCTCCCAAACATATTTTTAATTGCGGAGAACGCTAGCGC
AAGGTTATTCTCTGAGAAGGTGCTTCCGAAGCTAAAAGAAGTCTTCATAA
ATCACGTTCCGAGCACGACAGAGCACAAGACCGCTGCTGCAAAGATCGCT
GAACGGGAGAGGGAGTCTGGGCGTGAAGGTGGGCTAACAGTGCTACTATC
AAACTTAAACATCATTAAGGATAAGACTACTGCAAAGGAGTTTAAAGAGG
ATATACTATCGGTACATCGCGCTGCACTCGAGTCGCCAACCCATGCCTTG
CAAGATTTGGCCCTGCGCTCCATTCCAACAATCTTGCCAAAGCTTGACTT
TCCGACTCTAAAAAACGACCTATTCCCCGCTGTTGCTAGCGTGTTCACAA
AGACCTCATCCCTCGGGATTAAGATTCGCGGCCTAGAGGCTTTCAAAGTG
CTCTGTTCGCCAGCTGCTGCCGCAACCTCGGACGCACCGGAATTAGATAA
ATATACCATCCAGGAAAAGCTTATTCCATTATTGCGTGGAATCAAAACCA
AGGAACCCGCCGTCAGTATGGCGGCACTGGACGTGTTCAAGGTCATTGGC
AAGACGTGTGATAGGGAGGTTGTCGCCATGGAGATTCTGCCATGTCTCTG
GAGTATGAGCTTTGGGCCCCTATTAGGCGTAGAGCAGTTCACGGCGTTTA
TGGAGGTTGTGCGGCAGGTTAGTTCTCGGATTGAGGCAGAACAGGTACGG
AAGCTACAGGAGCTTAGGACCGAAGGGGAGAGTGGTGCTGGTGCGGGTGG
CATTTTAAGCTTCGGAGGAATGCCCGGGATAAGTTCCGGAATTACCGGAG
GTGGTGGGGACGATAACTTTGAAAATCTGATTTTCGGAAGGGGAGGTGGG
GATAAGTCTTTGCTCGTTAATAACGGTGGTTTCGATACTCCATGGAATAG
CACAAATGCAGGCGGGGGTGGTACGGTTACGGCACAAAGGTCCGAGCCAA
GGTTCAGTTGGTCTACTCCTTCCTCGACGACAAATCTCCATTCCTCCTCC
TCGTTCTCAGGAGAAGTATTACAACCTCAGCAGCAAACTCGGACGATGAC
CCCGGAAGC

Sequences in the Contig:

SY0AAB49YI19FM1 SY0AAB53YH16FM1 SY0AAC17YC19FM1
SY0AAC6YM20FM1