Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3800
Length(NT) : 814
Best Gene Model Blast : Link to GSTUMT00004686001 E-value : 2e-93
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3800
TTGGGACCGCCCCATGGTCCCTAAGGCTTATCTCATTATCGACTTCCGCG
CCGGCACTATCCGTGGCGAGGCGAGGATGGTTAGGAAACCTGTTAGGAAG
CCAGGCCAGCGAAGATGTGATGGCCCCCATGAGGAGATGACTTGGTATTT
CGGGGAGAAAATTGGGTACAACTAAAGGAAGAAAAAACCCAGTAATCTTC
CTTTAAGCTGTCGGTGCACCTCGGCCCCACATACTCACCTCGACCCTCGA
CATAGCTTTTACGCTCCCCACACTACCCTCGACTTAAAAAAGAAAAAGAA
AAAAAAAACAATCCCTCGAATACCATTCTCACAATGGAAACCAATCTCCT
TTGTTTTTTCTCAATATCAATTCTTTACCATCTCGGGCGGGCTTTTCTCG
GAGTTTATCTGGCGGGTTTGCGTATTTTTGATATCTCCTGACGGGATGAT
AGATGCAAGGTAAGGGTAATGACGGACAAGGGCAGGACGGTACCGGAATT
AAGGGGATTTTTTCTTTCGGCGCGATTGCAAAAAAAGTATTCTTTCTTTC
CATACTCATGTCGTTTCTCTATTTCTGGGTCTTACTACGGTGGCTTCCTT
CCTCTCTTACACTTTTTCTTTACTTCTACAAATGTCTTCAGGACAAACTA
TCTTCTCTTCTTGTCAAAAGGTCTTATCTTCTTTCCCTTTTTCTTTTCCC
TTACTCGCTCGATCATTCTCCTTTGTTGGGTCTGTTTCTGGAGTACACTT
TCCACGGCGCTGTATGGCTTTTAGATCTTAGAAAGGGCAACGGGTACGGT
TTTACTTGGGGGGT

Sequences in the Contig:

SY0AAB33YB06FM1 SY0AAC17YC17FM1 SY0AAC17YN05FM1
SY0AAD25YG14FM1