Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig380
Length(NT) : 1646
Best Gene Model Blast : Link to GSTUMT00008759001 E-value : 0.0
Numbers of ESTs : 17

Blast Results:

Nr Definition: calcium/calmodulin-dependent protein kinase
Accession: ref|XP_958895.2| Score: 1472 E_value: 1e-161
KEGG Definition: hypothetical protein
Accession: ncr:NCU09123.1 Score: 1480 E_value: 1e-162
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0032 Score: 688 E_value: 8e-73
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 642 E_value: 2e-67
Swissprot: Q00771|KCC1_EMENI
Gene Ontology:
GO:0004683 = Molecular function: calmodulin-dependent protein kinase activity

Sequence:
>Contig380
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCTTTTTTCTTTCTGACCTCTCCGCACCCTAACACCCCCTCTCT
CCTTTTTTTACACCACTTACGATACGGTGTGGTCCATCTATCGAAACCAA
CTCTTTCCTTGAAAGAGAAGAACAACAACCCCACCTCCTTCTGCAAGTTT
GTAAACATCGAATAGCAGACACCTTCTCTGCGTCTCATACCCTCCTATCT
GCTGTGCCATCAATCTATTTGTGTCTCTTCCCCATTTGCGCCCCGCTGCC
CGCAGATCCCTGAACCTCAACTATCAAAGCCACTGGGCAGACGGACAAAT
CCCTTCCTCCCAGCTCCCCGCATCACCCATTCACCCCTGACCTATTTACA
TATCTATAAACGAGAGGAACGTCGGAACTATGAGTTTTTCTTCGGTGCTC
AATAAACTGCACGGGCAGCCACCTACCTATGACAAGAAGTCACAGTACAA
GATGGGCCGCACCTTAGGTGCAGGTACCTATGGAATTGTTCGCGAAGCAG
ACGGACCCACCGGAAAAGTCGCTGTGAAAATCATTCTCAAGAAGAATGTC
AAGGGTAACGAGCAGATGGTATACGATGAACTGGCGTTGCTGCAGAGACT
CAAGCATCCGCACATTGTTTCGTTTAGGGATTGGTTTGAATCGAGAGACA
AATACTACATTGTCACTCAACTAGCGACCGGCGGAGAGCTTTTCGATCGC
ATTTGTGAGTATGGGAAATTTACCGAGAAGGATGCTTCTCAAGTCGTGCG
TGAGGTCCTGGATGCAGTGAATTACCTGCATAATAACAACATTGTGCACA
GAGATTTGAAACCCGAGAATCTTCTATACCTCACTCCTGATGCCAAATCT
TCCCTAGTTCTGGCAGATTTCGGTATTGCCAAAATGCTGGATTCGAGTGA
TGAGATGCTAAACACCATGGCTGGATCTTTTGGATACGCTGCACCTGAAG
TTATGCTAAAGAAGGGCCATGGAAAGGCTGTTGATATGTGGTCTTTGGGA
GTTATCACTTATACTCTCCTCTGTGGATACTCCCCGTTCCGTAGCGAGAG
TCTCCCTGATCTCATCGATGAATGTAGCAAAGGAGGTGTTATCTTCCACG
AGCGTTATTGGAAGGAGGTCAGCAAGGACGCGAAGCGCTTTATTGGCGGG
CTTCTCCAACCTAGGCCCGAAGACCGCCCCACCAGTCAGGAGGCGCTTAG
ACACACCTGGCTCATTGGCGAAACTGCCACCGACTACGATGTCCTTCCGG
AAATCAAGTCTTATATTGCAAAAGCTCGCCTCAGGCGTGGAATCGAAATG
GTTAAGCTTGCGAATCGTATTGAAGCACTCAAAATGAGGGCCGATGACCC
CGAAGAGGATTTGCCCACTGATACTGGGAAGGCGGCAACTGAAGGTGTTT
CTTCCGCTAGCCAAAATACATCGACATCAGGCGGTGCAAGAAGGCTCTCC
AGGGCTGCTAGATCGGCTATTTTCCGGGAAGTCGTCCTCGCTAAGGTTAG
GGAATTGAAGGCGGAGGAGGCCAAGCAGATGGCAGAGAGGACGTTGACCG
AGAGAAGCAAAAAGTAGATCACGGGTTAGGCTGTAGCTCGGCGAAT

Sequences in the Contig:

SY0AAA14YA08FM1 SY0AAA19YP03FM1 SY0AAA22YG16FM1
SY0AAA32YE24FM1 SY0AAA52YO22FM1 SY0AAA62YE05FM1
SY0AAA6YJ20FM1 SY0AAB24YJ23FM1 SY0AAB25YF05FM1
SY0AAB58YF15FM1 SY0AAB9YJ12FM1 SY0AAC23YJ20FM1
SY0AAC36YK15FM1 SY0AAC43YG21FM1 SY0AAD15YM06FM1
SY0AAD25YA03FM1 SY0AAD52YL23FM1