Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig38
Length(NT) : 1229
Best Gene Model Blast : Link to GSTUMT00002846001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: hypothetical protein An12g00850
Accession: ref|XP_001395174.1| Score: 470 E_value: 5e-45
KEGG Definition: hypothetical protein
Accession: ang:An12g00850 Score: 470 E_value: 2e-45
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>Contig38
TGTACAAAAAGTTGGAAGTTATCTTTACGAACGTCAAACACGCTCATTTC
TTACCTCGATAAAACCCGGCTTCTCGCAATTCAAAAATTAACCTACAAGA
TGGGTAATGAACGATCAAACACTCGTTTTGAGGTTCCTTCCTCACACCAG
CGTCACCACGGTTCCAACTCTGGGGCCAGCAGCATTGTTCAAGGCAATTA
TAGCGGCAACGTCGGAAATTATAATATCTACGGCTCCGGTAACTCCATTT
ACTACCACCAAGTCCAGGACTTGCTACCCACGGATGACGAGGTTTTGCGA
TGCCTATACAGGTGTGCGTACCAGGAGCAGCGAAAACGGGTTCGGGAGCC
AGCCACGGGAACATGCACTTGGGTTACGGAACATCCAAATTATAAGAACT
GGTTGGAAAAGCAGACATCAGATCTCCTCTGGTTATCGGCAGACCCTGGT
TGCGGAAAATCAGTCATAGCATCTTTCCTCGTAACCCACCTTGAAACCAA
TACGAACGCCACTATTTGCTATTTCTTTTTTAAAGACGACAGCAAAGATC
AAATGAGCGCAACATTTGCACTTTGCGCGATACTTCATCAGCTTTTTGTG
CAGAGAAAATTTGTCAGTGAACATGCCAAGGAAGTGTTTGGGTCTAAAGG
GGGGGTGTTTACGGACGAGGTCTATACATTGTGGGAGATTTTGGTTAAAG
CAGTGGCGCTGGAACAGTGCGGCAACGTGATTTGTGTTATAGACGCATTA
GACGAGTGCTCACGAAAGACTCAGGAGCAACTCATTCCGCTCCTGGCTCC
CCTCTCTGGGTCACGAAATCCTGAGATACCTTTGAAACTCCTCGTTACAA
GTCGTCCATACAGCTTAATTGAGAGGGGCCTTTGTTTACGCACACCGACA
ATCCGGCTGAAAGGCGAGGAAGAGATCGGTGCTGTTACTGCTGACATTAC
TCGTTTTATAGGTGATGGCATCGCGGAGCTGGAGGAATACTGGAAAAGGC
CTGGCGGGCTTGGATACTTGCGAAACCTCCTCGAATCCTCTGCCGATCGG
ACATTCCTTTGGGTTTCCCTTGTTCTCACGGAATTGAAGGCTTCCGAGGA
TTGTTCGTCGGAGGAGTTGACCCGCATTGCCACCACTGCACCACGCGATC
TGGCGGAATTTTATAGCAAGATTCTTGGGAATATCCGATCACACACCAAA
GCCCTGAAAATCTTAAAAATAGCGGTAGC

Sequences in the Contig:

SY0AAA11YG21FM1 SY0AAA23YJ13FM1 SY0AAA45YN21FM1
SY0AAA49YC16FM1 SY0AAA53YP21FM1 SY0AAA58YF13FM1
SY0AAB32YO23FM1 SY0AAB41YN10FM1 SY0AAB51YO14FM1
SY0AAB53YE09FM1 SY0AAC59YF04FM1 SY0AAD53YC19FM1