Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3799
Length(NT) : 1150
Best Gene Model Blast : Link to GSTUMT00006228001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3799
TTGGCCTTTCCCTGCATTATCCCTCTTCTTTCAGACCCTTTCTACACGCC
GACGTCTATCCTTTAATACCCTAGTTGCATCTTTTTTTCCTTACCATCGT
CCTCTTCTACCCAAACTCCACCGACGTCAATCACCGCTAGGCATTATCAC
TTGATGTCTGCTCCGACCTCTACCCTCCCGGCAGAGGTGGCCCCTAATCA
CCATTCTACGCTGGGAGAGAAAGATTCCGTGAGACCGCGAAGTGGCAGTC
ATTCCTCCACTTGGTCATATGACGAAAAGCACCCCGTCCATTCGACCCTG
GATGATGATGAGGAAGATTTCCTTCCAGTTGGAGCCGAAGTATCCCCCGC
GGTGGAGAGACGTATGTCCGCCAAGCATGACTATTCCCGTGAGCATGAGC
CCCGCGACCGGAGATATAGTGGCACTTCAGCCCACAGGGGTCCTCCATCC
CGCAAGCCTACCGCGAGCTACGGGTACGACCCCGTAACCGGCCAGCCGGA
TACTGGGATGGGCTCACCTTCGCAACAACTCGCGAACATCGATTGGGCGC
ACGTACTCGCGGCCTCTGAAAATAAGCATGCCGCCCCCGCCGCCACCACC
TCGCCGACTCACTCGAGAAAGACTCCCTCCCGAAAGCCTACAGCCAGCTA
TGGCATTGACCCCGTCATGGGACATCCAGAGCACGGCCACCACCACCATC
CTTACCCTATTTCTGAGAATCAGCCCGTTAGGACAGAGGTCAGTTCTTCC
GCTGCAGATCCTGGTAGCCAGCTCACCGCTGAGGGACCGGGAATTATTAG
AACTGAATCTGGCGTCACGATGACCAATCTCCGCATCTCCTGCGAGTATC
CTAAGCCCACTTAGATTTTGCGCCTAACTAGGTGCTTTTTTCTTTTTACT
TAATATTTGGTTCTCTCACGTCACGCCAGATCCCTTTTTTTGACACTTTT
TTACTTTTCACTTTGCCATTTTCCCTATTTTCCTATGTAACAAGAATTCA
CGCTGTCTCATAACGTGTAGGCATTGGTTGGGACGAAGTGGCAGCACCGA
TAAACTGTTTTGGGCTTTCATCTGATTATTCACTTTCGGAACACTTGCTC
TTCCGAGTGGTATATTACCTCGAATTAACATTGATGTCGGTGGTCACGCA

Sequences in the Contig:

SY0AAC13YG04FM1 SY0AAC17YC06FM1 SY0AAC41YK21FM1
SY0AAC45YF11FM1 SY0AAC48YP10FM1 SY0AAD58YO14FM1