Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3798
Length(NT) : 774
Best Gene Model Blast : Link to GSTUMT00005607001 E-value : 8e-68
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Chromatin structure and dynamics].
Kog Number: KOG4364 Score: 162 E_value: 3e-12
PFAM Definition: Myosin_tail_1, Myosin tail. The myosin molecule is a multi-subunit complex made up of two heavy chains and four light chains it is a fundamental contractile protein found in all eukaryote cell types. This family consists of the coiled-coil myosin heavy chain tail region. The coiled-coil is composed of the tail from two molecules of myosin. These can then assemble into the macromolecular thick filament. The coiled-coil region provides the structural backbone the thick filament..
Pfam Number: pfam01576 Score: 119 E_value: 3e-07

Sequence:
>Contig3798
TTGGCGAAAAGATAGGAACAAAGGAAAGGCTTAATCAAGCTTTAGAGCCT
ACGGCAACATCCTCCCACACTTTCTCACTATCCCTCTGTTCTTTCCTTTC
CAACTCCTCGACTCTCGCTCTCAAGTCCAGATTCTCTCTCGTCAAACCTT
CTACCACCTTTTTCAATTCCCCAATCTCTCGTCTATCCCTCCCCTCTTTC
CTCTCCCGTTTCTCCTCCCTCCGCTTCGCCTTCTCTATATCCTTGCGATA
ACGGTCCTCGCGTTTTTCTACCTCTTTTAAATGTTTTTCTAGCAGTTTCT
TTTCCTTCTCTCCATCTTTCGATCGCTTCCGCTCCTCCTTTTCCATTTGC
TTCGCCAACTTCGCTGATAGCTTTGACTTCTCGCGAAGAAGACGATTTAG
GGCTTTTTCTTCGTGGGTGGTATGGGGGCGTCGGCTGGTGGTAGTTGACG
GGGTGGTGTGGGTTGATGATGCTGAAGAGGAAGCGATTCTGCATCGGATC
TATCGTCCGGGGCGTCGTTGCCGAGGGTGAAACCCGTCGAATGCGTCGGG
GTTCCAGGGGGAGCAGGGGAGGAGGCTACTGTTGTGCTCGGTGTGTATAT
TACTGAGGGCACGACAGCAGCTACACTAGTGGAAAGGGTGTTGACAGCTG
AAGAAATTAGGCCTCCGCCCGTTGCTCGCTCTCCTCCCCAAGAATCCAGA
TCCGGCGCACCGATATCCTGTTTAGACTCCTCATGTTTTTGCTGACCAGG
TACCGTTCCTTCTCTCAGTTCATC

Sequences in the Contig:

SY0AAC17YA24FM1 SY0AAC33YC05FM1