Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3797
Length(NT) : 822
Best Gene Model Blast : Link to GSTUMT00011025001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3797
TTGGATAGGACCAACCCTCCAATAAAAAAGAGAAAAGATGCGCCTATTCC
AGAGAGTATCGATGCTCGTAGAGGGGCGAGGGTTGTGCAAGTGGGGAAAA
AACAAGAGGACGCTAGGGAGCCAAGGGTGGTGGGAGAGAAACAAAGCGCA
GTGGCTCAAGAGAATGCGCTAGGTCATAAAACTACAGCTATGAGCTCAAA
ACGTAAGGCCCATAAACCCACAATCACTCCAAAAGAGCTCAGCGAAGGTT
CTCATAAACGCCAACGAACCTCGTCCCCCAAAACGGTCGGCTATGGAAAG
AAGGGAGGAGCTCTTGCGCCCACGCTCAATGCAAATGATAACTCCGGAGC
TATAACATCCTTTCCTCAAATGGATGTGTCCCCTGAAGTTCGAGATTCGG
GCCGTGGGGGGCCTGACTTGGATGAGTGGGCGGTATATAATGGCGATACT
TTGCCACCACTCAACAAGAAGGAATATATAAATCATAAGGGAAATAGAGA
AGAAAGAACTTCAAATATTTCGGGTCCAGCAACGCCTCCGGAGCCTAACG
CTCACTGCCCACAGACAGCACAAAAAATATTTGGAGGCCTGGATGATGCA
AGTAAGGGGGCATTTACGCTTGGCCGAGAGTCTCAAAAGTGTCGACTTAG
TTCACTAGAAAAATTTCCGAAAGAATTGCCACCCCAAGAGGCGATAAATC
TCGCAAAAGGACTCTCGAGAGCGGATACTCATGGTACATATGGTCCTTCG
GGATCTTCAACAGCCCCCCATGACCCACAAGAAAGTCTTCGTGGGAACGC
CCCAGCTGCATTAGCCAATATA

Sequences in the Contig:

SY0AAC17YA18FM1 SY0AAC20YH12FM1